ID: 1047453623

View in Genome Browser
Species Human (GRCh38)
Location 8:124989260-124989282
Sequence GCCTTGCTCCAAAATCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047453623_1047453629 27 Left 1047453623 8:124989260-124989282 CCTTTAGGATTTTGGAGCAAGGC No data
Right 1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047453623 Original CRISPR GCCTTGCTCCAAAATCCTAA AGG (reversed) Intergenic
No off target data available for this crispr