ID: 1047453624

View in Genome Browser
Species Human (GRCh38)
Location 8:124989282-124989304
Sequence GTTATCTGTGGATGATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047453624_1047453629 5 Left 1047453624 8:124989282-124989304 CCCTGCTATCATCCACAGATAAC No data
Right 1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG No data
1047453624_1047453631 16 Left 1047453624 8:124989282-124989304 CCCTGCTATCATCCACAGATAAC No data
Right 1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047453624 Original CRISPR GTTATCTGTGGATGATAGCA GGG (reversed) Intergenic
No off target data available for this crispr