ID: 1047453625

View in Genome Browser
Species Human (GRCh38)
Location 8:124989283-124989305
Sequence AGTTATCTGTGGATGATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047453625_1047453631 15 Left 1047453625 8:124989283-124989305 CCTGCTATCATCCACAGATAACT No data
Right 1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG No data
1047453625_1047453629 4 Left 1047453625 8:124989283-124989305 CCTGCTATCATCCACAGATAACT No data
Right 1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047453625 Original CRISPR AGTTATCTGTGGATGATAGC AGG (reversed) Intergenic
No off target data available for this crispr