ID: 1047453626

View in Genome Browser
Species Human (GRCh38)
Location 8:124989294-124989316
Sequence AAAAGGAGGGTAGTTATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047453626_1047453631 4 Left 1047453626 8:124989294-124989316 CCACAGATAACTACCCTCCTTTT No data
Right 1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG No data
1047453626_1047453633 25 Left 1047453626 8:124989294-124989316 CCACAGATAACTACCCTCCTTTT No data
Right 1047453633 8:124989342-124989364 GGACCTTAGCAGAAACTAAATGG No data
1047453626_1047453629 -7 Left 1047453626 8:124989294-124989316 CCACAGATAACTACCCTCCTTTT No data
Right 1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047453626 Original CRISPR AAAAGGAGGGTAGTTATCTG TGG (reversed) Intergenic
No off target data available for this crispr