ID: 1047453629

View in Genome Browser
Species Human (GRCh38)
Location 8:124989310-124989332
Sequence TCCTTTTGAAAGATAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047453624_1047453629 5 Left 1047453624 8:124989282-124989304 CCCTGCTATCATCCACAGATAAC No data
Right 1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG No data
1047453623_1047453629 27 Left 1047453623 8:124989260-124989282 CCTTTAGGATTTTGGAGCAAGGC No data
Right 1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG No data
1047453626_1047453629 -7 Left 1047453626 8:124989294-124989316 CCACAGATAACTACCCTCCTTTT No data
Right 1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG No data
1047453625_1047453629 4 Left 1047453625 8:124989283-124989305 CCTGCTATCATCCACAGATAACT No data
Right 1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047453629 Original CRISPR TCCTTTTGAAAGATAGCTCT TGG Intergenic
No off target data available for this crispr