ID: 1047453631

View in Genome Browser
Species Human (GRCh38)
Location 8:124989321-124989343
Sequence GATAGCTCTTGGCCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047453626_1047453631 4 Left 1047453626 8:124989294-124989316 CCACAGATAACTACCCTCCTTTT No data
Right 1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG No data
1047453625_1047453631 15 Left 1047453625 8:124989283-124989305 CCTGCTATCATCCACAGATAACT No data
Right 1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG No data
1047453627_1047453631 -9 Left 1047453627 8:124989307-124989329 CCCTCCTTTTGAAAGATAGCTCT No data
Right 1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG No data
1047453628_1047453631 -10 Left 1047453628 8:124989308-124989330 CCTCCTTTTGAAAGATAGCTCTT No data
Right 1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG No data
1047453624_1047453631 16 Left 1047453624 8:124989282-124989304 CCCTGCTATCATCCACAGATAAC No data
Right 1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047453631 Original CRISPR GATAGCTCTTGGCCTGCTAC TGG Intergenic
No off target data available for this crispr