ID: 1047454214

View in Genome Browser
Species Human (GRCh38)
Location 8:124994384-124994406
Sequence TATACTCAGTATTTGGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047454214_1047454217 11 Left 1047454214 8:124994384-124994406 CCATATGCCAAATACTGAGTATA No data
Right 1047454217 8:124994418-124994440 AAGACATGGTCCTTGTCTTGAGG No data
1047454214_1047454216 -3 Left 1047454214 8:124994384-124994406 CCATATGCCAAATACTGAGTATA No data
Right 1047454216 8:124994404-124994426 ATACAACTGTGAATAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047454214 Original CRISPR TATACTCAGTATTTGGCATA TGG (reversed) Intergenic
No off target data available for this crispr