ID: 1047457449

View in Genome Browser
Species Human (GRCh38)
Location 8:125028974-125028996
Sequence GTATTGAATCATGTAAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047457449 Original CRISPR GTATTGAATCATGTAAACAG AGG (reversed) Intronic
903004061 1:20286817-20286839 GCTTTCAATCATGTAAACAGAGG + Intergenic
905547414 1:38810751-38810773 GTTTTGAATCAAGTAGACTGAGG + Intergenic
910068237 1:83179873-83179895 GTACTTAATGATGTAAACTGGGG + Intergenic
912092867 1:106103263-106103285 GTCTTGACTAATGTAAACAATGG + Intergenic
915794870 1:158719105-158719127 GAATGGAATCGTGGAAACAGAGG - Intergenic
919225876 1:194700661-194700683 GAATTGAATCATTTTAAAAGAGG - Intergenic
919740519 1:200978671-200978693 ATAATGAATAAAGTAAACAGAGG - Intronic
921425231 1:214993682-214993704 ATAATGAATCATGAAAACACAGG + Intergenic
924846343 1:247776410-247776432 GTTTTGACTTATGTAAACACTGG + Intergenic
1065719688 10:28614472-28614494 GTCTTGAAACATGTAAAATGTGG - Intronic
1066643689 10:37583027-37583049 GTATTCAGTTTTGTAAACAGTGG - Intergenic
1070056475 10:72939855-72939877 CTATTGAATGATTTACACAGGGG + Intronic
1071813154 10:89205477-89205499 GGATGGATTCATGAAAACAGGGG + Intergenic
1072174838 10:92909922-92909944 GTATAGAATTAGCTAAACAGTGG + Intronic
1083321427 11:61849657-61849679 GTATAGCATCTTGTTAACAGTGG - Intronic
1086844013 11:91725670-91725692 ATATTCAATCAAGTAAAGAGAGG + Intergenic
1087130021 11:94660852-94660874 GTTTTGAATAAATTAAACAGTGG + Intergenic
1088618321 11:111656242-111656264 GTTTTGAATTATCAAAACAGTGG + Intronic
1089081346 11:115778496-115778518 GTGTGGCATCATGAAAACAGTGG + Intergenic
1089206049 11:116763541-116763563 GTATTACAGCATGAAAACAGAGG + Intronic
1089677674 11:120100718-120100740 AAATTGAATTATGTAATCAGTGG + Intergenic
1093877241 12:24363492-24363514 ATTTTGTATCATGTAACCAGTGG - Intergenic
1095220303 12:39605203-39605225 GAATTTCATCATGTAAACAGAGG - Intronic
1098419714 12:70281608-70281630 TTCTTGAATCATGTGAACAAAGG - Intronic
1099172646 12:79383262-79383284 GTACTGAATATTGTAAGCAGTGG + Intronic
1104316392 12:127706556-127706578 GTCTTTAAACATATAAACAGAGG + Intergenic
1106946238 13:34830861-34830883 ATATTGAACCAGGTAATCAGAGG - Intergenic
1107226596 13:38056618-38056640 GAACTGAATCCTGTAGACAGTGG + Intergenic
1107859155 13:44644247-44644269 TTTTTGAATCATTTAAAAAGTGG - Intergenic
1110929812 13:81200693-81200715 ATATAGAATCATGTAACCATAGG + Intergenic
1113010315 13:105757706-105757728 GTAATGAATGATGTTAACTGGGG - Intergenic
1114316355 14:21513119-21513141 GTATGGCATCATGTAGACATTGG - Intergenic
1117107497 14:52413105-52413127 TTATTGAAAAATGTAAACAGTGG - Intergenic
1117692303 14:58320487-58320509 GAATTGGATCCTGTAATCAGGGG - Intronic
1117706219 14:58471396-58471418 TTTTTGTATCATGTCAACAGTGG - Intronic
1119185632 14:72640251-72640273 GAATTTAATTCTGTAAACAGTGG + Intronic
1120775193 14:88427036-88427058 ATATTGATTCATGTTAAAAGTGG + Intronic
1122327657 14:100892034-100892056 GTATTATTTCATTTAAACAGAGG + Intergenic
1127550710 15:60035423-60035445 GTGTTGGATCACGTAGACAGTGG + Intronic
1130093071 15:80837344-80837366 GTCTAGAATCAGGTAAGCAGAGG + Intronic
1131808924 15:96152441-96152463 GTACTGAATGATGTAGACAATGG + Intergenic
1140540180 16:75749692-75749714 GTATGTAATCATGTGAAGAGAGG + Intronic
1153602170 18:6791504-6791526 GTATTTAAATATGTAAACATTGG + Intronic
1155015695 18:21836715-21836737 GTATTAAATCATGTGAAAAGTGG - Intronic
1155069246 18:22298865-22298887 GTTTTAAATCATTTAAAAAGTGG + Intergenic
1158390282 18:57039398-57039420 GTATTGAATCCTGTAGACAATGG + Intergenic
1158465075 18:57682641-57682663 GTCCTGAATCATGGAAGCAGAGG - Intronic
1158914698 18:62111351-62111373 AAACTGAATGATGTAAACAGAGG - Intronic
1167219966 19:48192714-48192736 CTAGTGAATCATGGAAACTGAGG - Intronic
924980277 2:213413-213435 GGTTTGAATCTTGAAAACAGAGG + Intergenic
927526863 2:23751646-23751668 GTGTTGAATTGTTTAAACAGTGG - Exonic
930709349 2:54535481-54535503 AAATTGAATCATGTAATCTGTGG + Intronic
932942796 2:76188913-76188935 TTTGTGAATCATGTAATCAGAGG + Intergenic
933528888 2:83480144-83480166 GTATTGAGTAGTGTAAAGAGTGG + Intergenic
935320579 2:101884417-101884439 TTATTGATTTATTTAAACAGTGG + Intronic
938165936 2:129026936-129026958 TTATTGAAACATGTGAACACAGG - Intergenic
940832226 2:158479856-158479878 ATATTAAGTCAAGTAAACAGAGG - Intronic
941698289 2:168576663-168576685 GTATGGCATCATGTTAACAGTGG - Intronic
944887304 2:204076529-204076551 GCATTGAATCATGGAACAAGAGG - Intergenic
945374661 2:209065973-209065995 TTATTGAATGATGTAAGCAATGG - Intergenic
945687615 2:212991469-212991491 GAATAGACTCATGGAAACAGGGG - Intergenic
946547730 2:220763568-220763590 GTATTGAATCCTTTAAACTGAGG + Intergenic
947160951 2:227213587-227213609 GTTTTTAATCATCTAAAAAGCGG - Intronic
947175442 2:227362290-227362312 TTAATGAATAATGTAAACATAGG + Exonic
947649518 2:231773800-231773822 TTATTGAATCATTTATTCAGAGG + Intronic
1169743873 20:8923438-8923460 GTATAGAATTATGTTATCAGTGG - Intronic
1170169079 20:13391597-13391619 GCATCAAATCATATAAACAGTGG + Intronic
1180659915 22:17457835-17457857 GTATTGATTCATGCAAAAACTGG + Intronic
949583127 3:5411002-5411024 GTATTGATTCACATAACCAGAGG - Intergenic
952207194 3:31191765-31191787 GTATTGAATCATGCAAAATTTGG - Intergenic
953216915 3:40927400-40927422 ATTTTAAATCATTTAAACAGGGG - Intergenic
953693054 3:45135993-45136015 GGATTGAAACATGTAAACCAGGG - Intronic
955505731 3:59631437-59631459 GTTTGGAATCATGTAAATATAGG + Intergenic
955957129 3:64302458-64302480 GTTTTGAATCATGTTAAAAAAGG - Intronic
959239796 3:103775693-103775715 GTCATGAATCATATAAACATGGG + Intergenic
963672629 3:148270981-148271003 GTATTGATTAATTTAAATAGAGG - Intergenic
965054879 3:163699177-163699199 GTAATGAATCCGATAAACAGAGG - Intergenic
965156746 3:165069046-165069068 ATATTGAATCATTATAACAGAGG + Intronic
966286204 3:178298424-178298446 GAATTTAAACATGTAAAAAGTGG + Intergenic
967372343 3:188760796-188760818 GTTTTTAATGATGCAAACAGGGG + Intronic
970136761 4:12933590-12933612 ATATTTACTCAAGTAAACAGAGG + Intergenic
972943264 4:44222875-44222897 GTATTGGATAAGGTAAACAGTGG + Intronic
972964401 4:44491668-44491690 GGATAAAATCATGTAAACCGAGG - Intergenic
976240833 4:82955029-82955051 TTCTTGAATCATATTAACAGTGG - Intronic
979095729 4:116547761-116547783 GGATTGGATAATGTAAACAGTGG + Intergenic
979913589 4:126403591-126403613 GGTTTGAATCTTGTCAACAGTGG + Intergenic
980197543 4:129610182-129610204 ATATTGATACATGTAAACACTGG + Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982561860 4:156937785-156937807 GTATTGTATTGTGTAAACACAGG - Intronic
985042612 4:185906662-185906684 GTATGGAATCATATAAACAGTGG - Intronic
985292072 4:188396334-188396356 GTATTAACTTATGTCAACAGTGG - Intergenic
985789570 5:1918371-1918393 ATAATGAATCATGGAAATAGAGG + Intergenic
987069708 5:14324396-14324418 GTATTGTATCTTGAGAACAGTGG + Intronic
989360851 5:40599737-40599759 GTAATCAATCATGTAATCAGAGG - Intergenic
990147147 5:52775211-52775233 GTTTGGTATCATGTAAACATGGG - Intergenic
992910417 5:81391143-81391165 ATCTTGAATCATGTATACATAGG - Intronic
993348331 5:86814048-86814070 GAATTGATTCATTGAAACAGTGG + Intergenic
994735603 5:103551032-103551054 TAATTGAATTATGTAAACATGGG - Intronic
994803770 5:104416414-104416436 GTATACAACCATGTAATCAGTGG - Intergenic
996209791 5:120793875-120793897 GTATTGAATACTGTAAGCAGTGG + Intergenic
996276716 5:121675585-121675607 GTATTGAATCATGTAAGACCAGG + Intergenic
999512413 5:152266503-152266525 GTAATTAACCATGTAAACTGCGG - Intergenic
999866718 5:155708651-155708673 ATAATGAGTCATTTAAACAGGGG + Intergenic
999939688 5:156528595-156528617 GTATTCAACTATGTAGACAGTGG + Intronic
1005684459 6:28239440-28239462 GTTTTCAAACATGTAAATAGGGG - Intergenic
1006595141 6:35187430-35187452 GGATTGCATCAGGTACACAGAGG - Intergenic
1009239629 6:61168493-61168515 GAATTGGATAATGTAAACAAAGG - Intergenic
1010461581 6:76119910-76119932 GAAGTGAAACATGTTAACAGTGG + Intergenic
1011962361 6:93106694-93106716 GTATCCAATCATGAGAACAGAGG + Intergenic
1012023353 6:93955280-93955302 GTATTGAATCATAAAAAGAAAGG - Intergenic
1012281766 6:97336107-97336129 ATTCTCAATCATGTAAACAGGGG - Intergenic
1013718349 6:112991029-112991051 TTATAGAAGCATGTAACCAGGGG + Intergenic
1015915491 6:138212215-138212237 TTCTTGAAAAATGTAAACAGTGG - Intronic
1017155638 6:151320452-151320474 GGATTAAAACATGGAAACAGTGG - Intronic
1020734221 7:11926621-11926643 GAATTGAATCACATGAACAGTGG - Intergenic
1020745972 7:12078052-12078074 GGATTTAAAAATGTAAACAGGGG - Intergenic
1020885036 7:13809992-13810014 GTAATCCAGCATGTAAACAGAGG + Intergenic
1022052254 7:26688101-26688123 GTTATGAAACATGTAGACAGAGG + Intronic
1023467602 7:40474411-40474433 CTTTGGAATCATGTAACCAGAGG + Intronic
1027275861 7:76554900-76554922 GTACTTAATGATGTAAACTGGGG - Intergenic
1028866271 7:95717229-95717251 GTATTGTATAATGTTAATAGAGG + Intergenic
1031649971 7:124276555-124276577 GTCTTAAATCTTGTACACAGAGG - Intergenic
1032690742 7:134283913-134283935 GTTGTTAATTATGTAAACAGAGG - Intergenic
1033363395 7:140653672-140653694 GCATTGAATCTTCTCAACAGTGG - Intronic
1033908508 7:146236306-146236328 ATATTTATTCATGTTAACAGTGG + Intronic
1035889852 8:3331319-3331341 GTAAAGAATCATGTAACCAGAGG + Intronic
1041945717 8:63439934-63439956 GATTTTAATAATGTAAACAGTGG + Intergenic
1045116351 8:98986353-98986375 ATATTTAATCATGTAATAAGAGG + Intergenic
1046549396 8:115694830-115694852 GTATTGAATACTGTTAGCAGTGG + Intronic
1046649744 8:116824708-116824730 GTGGTGAATCTTGTAATCAGGGG - Intronic
1047457449 8:125028974-125028996 GTATTGAATCATGTAAACAGAGG - Intronic
1048950509 8:139492831-139492853 GGAGAGAATCATGTAATCAGGGG - Intergenic
1050118721 9:2286928-2286950 CTATTGAATGAAGTCAACAGGGG + Intergenic
1053627079 9:39885397-39885419 GTACTGAGTCATGCTAACAGTGG + Intergenic
1053778912 9:41580625-41580647 GTACTGAGTCATGCTAACAGTGG - Intergenic
1054166872 9:61790865-61790887 GTACTGAGTCATGCTAACAGTGG - Intergenic
1054216808 9:62365306-62365328 GTACTGAGTCATGCTAACAGTGG - Intergenic
1054670674 9:67790034-67790056 GTACTGAGTCATGCTAACAGTGG + Intergenic
1055543428 9:77340459-77340481 GTTTTTAATCATATAAAAAGGGG - Exonic
1187777227 X:22774957-22774979 GTAGAGGATCATGTAAACTGGGG - Intergenic
1188807309 X:34607345-34607367 TTATTGAATCATTGAAACACTGG + Intergenic
1190583745 X:51916231-51916253 ATATTGAAACATGTATACATTGG + Intergenic
1191633430 X:63350586-63350608 ATATTTAATGATGTAAAGAGTGG + Exonic
1193020999 X:76793205-76793227 GTATTGAAATATGCTAACAGTGG - Intergenic
1194273187 X:91846147-91846169 GTATTGATTAATGTAAAAAATGG + Intronic
1198136575 X:133757409-133757431 TTATTGAACCATTTAAAGAGAGG - Intronic
1200023686 X:153235484-153235506 GTATTCAATGATGTAGAAAGGGG - Intergenic
1200590430 Y:5067542-5067564 GTATTGATTAATGTAAAAAATGG + Intronic
1201342213 Y:12946987-12947009 GAATTGAACCCTGGAAACAGAGG - Intergenic