ID: 1047457927

View in Genome Browser
Species Human (GRCh38)
Location 8:125033099-125033121
Sequence GACCCTGACCTCTGCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047457921_1047457927 22 Left 1047457921 8:125033054-125033076 CCACTGCACCTGGCTCTACACTA No data
Right 1047457927 8:125033099-125033121 GACCCTGACCTCTGCCTGGGTGG No data
1047457922_1047457927 14 Left 1047457922 8:125033062-125033084 CCTGGCTCTACACTAAAGATTTC No data
Right 1047457927 8:125033099-125033121 GACCCTGACCTCTGCCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047457927 Original CRISPR GACCCTGACCTCTGCCTGGG TGG Intronic