ID: 1047461535

View in Genome Browser
Species Human (GRCh38)
Location 8:125070293-125070315
Sequence TGTGTGACTCACAATCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047461532_1047461535 10 Left 1047461532 8:125070260-125070282 CCACAAAAGTTAACTAAGCAGTT 0: 1
1: 0
2: 2
3: 15
4: 179
Right 1047461535 8:125070293-125070315 TGTGTGACTCACAATCAGATAGG No data
1047461531_1047461535 24 Left 1047461531 8:125070246-125070268 CCATGACTGAAATTCCACAAAAG 0: 1
1: 0
2: 0
3: 22
4: 172
Right 1047461535 8:125070293-125070315 TGTGTGACTCACAATCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047461535 Original CRISPR TGTGTGACTCACAATCAGAT AGG Intronic
No off target data available for this crispr