ID: 1047466889

View in Genome Browser
Species Human (GRCh38)
Location 8:125125420-125125442
Sequence AGGGTGAATTTTGAGCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047466886_1047466889 5 Left 1047466886 8:125125392-125125414 CCATCTATTATCACAGAGCGGGT 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1047466889 8:125125420-125125442 AGGGTGAATTTTGAGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047466889 Original CRISPR AGGGTGAATTTTGAGCTGAG AGG Intronic
No off target data available for this crispr