ID: 1047473566

View in Genome Browser
Species Human (GRCh38)
Location 8:125203342-125203364
Sequence ACTAATATCTAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047473562_1047473566 -6 Left 1047473562 8:125203325-125203347 CCCATGGACCTTGCATAACTAAT 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG No data
1047473560_1047473566 16 Left 1047473560 8:125203303-125203325 CCAGATTATAGACTGTATCATAC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG No data
1047473559_1047473566 24 Left 1047473559 8:125203295-125203317 CCTGTTTGCCAGATTATAGACTG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG No data
1047473563_1047473566 -7 Left 1047473563 8:125203326-125203348 CCATGGACCTTGCATAACTAATA 0: 1
1: 0
2: 1
3: 15
4: 140
Right 1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047473566 Original CRISPR ACTAATATCTAGAAAGAGGA AGG Intronic
No off target data available for this crispr