ID: 1047476763

View in Genome Browser
Species Human (GRCh38)
Location 8:125239950-125239972
Sequence CCCCTTCTTGCTCATTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047476758_1047476763 -7 Left 1047476758 8:125239934-125239956 CCCACTCTGATCCCTGCCCCTTC 0: 1
1: 0
2: 1
3: 55
4: 552
Right 1047476763 8:125239950-125239972 CCCCTTCTTGCTCATTGCTGAGG No data
1047476757_1047476763 17 Left 1047476757 8:125239910-125239932 CCTGAGAAGTAAGTAAGTGTGTC 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1047476763 8:125239950-125239972 CCCCTTCTTGCTCATTGCTGAGG No data
1047476759_1047476763 -8 Left 1047476759 8:125239935-125239957 CCACTCTGATCCCTGCCCCTTCT 0: 1
1: 0
2: 8
3: 79
4: 733
Right 1047476763 8:125239950-125239972 CCCCTTCTTGCTCATTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047476763 Original CRISPR CCCCTTCTTGCTCATTGCTG AGG Intronic
No off target data available for this crispr