ID: 1047492798

View in Genome Browser
Species Human (GRCh38)
Location 8:125388376-125388398
Sequence CTCTTTGTTGGCTTCTTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047492798_1047492809 11 Left 1047492798 8:125388376-125388398 CCCCCGAAGAAGCCAACAAAGAG No data
Right 1047492809 8:125388410-125388432 TGAGGAACGCTGGCTGATGGGGG No data
1047492798_1047492808 10 Left 1047492798 8:125388376-125388398 CCCCCGAAGAAGCCAACAAAGAG No data
Right 1047492808 8:125388409-125388431 CTGAGGAACGCTGGCTGATGGGG No data
1047492798_1047492803 -7 Left 1047492798 8:125388376-125388398 CCCCCGAAGAAGCCAACAAAGAG No data
Right 1047492803 8:125388392-125388414 CAAAGAGCCACTCAGAACTGAGG No data
1047492798_1047492811 23 Left 1047492798 8:125388376-125388398 CCCCCGAAGAAGCCAACAAAGAG No data
Right 1047492811 8:125388422-125388444 GCTGATGGGGGAAAAGGTAGCGG No data
1047492798_1047492805 1 Left 1047492798 8:125388376-125388398 CCCCCGAAGAAGCCAACAAAGAG No data
Right 1047492805 8:125388400-125388422 CACTCAGAACTGAGGAACGCTGG No data
1047492798_1047492810 17 Left 1047492798 8:125388376-125388398 CCCCCGAAGAAGCCAACAAAGAG No data
Right 1047492810 8:125388416-125388438 ACGCTGGCTGATGGGGGAAAAGG No data
1047492798_1047492806 8 Left 1047492798 8:125388376-125388398 CCCCCGAAGAAGCCAACAAAGAG No data
Right 1047492806 8:125388407-125388429 AACTGAGGAACGCTGGCTGATGG No data
1047492798_1047492807 9 Left 1047492798 8:125388376-125388398 CCCCCGAAGAAGCCAACAAAGAG No data
Right 1047492807 8:125388408-125388430 ACTGAGGAACGCTGGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047492798 Original CRISPR CTCTTTGTTGGCTTCTTCGG GGG (reversed) Intergenic
No off target data available for this crispr