ID: 1047499271

View in Genome Browser
Species Human (GRCh38)
Location 8:125429741-125429763
Sequence GGGGCGAAAGGCGTCGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047499262_1047499271 5 Left 1047499262 8:125429713-125429735 CCAGGCGCTGGGCGGTGGGGGGA No data
Right 1047499271 8:125429741-125429763 GGGGCGAAAGGCGTCGCCGCGGG No data
1047499250_1047499271 19 Left 1047499250 8:125429699-125429721 CCAACCGGAGCTCCCCAGGCGCT No data
Right 1047499271 8:125429741-125429763 GGGGCGAAAGGCGTCGCCGCGGG No data
1047499248_1047499271 27 Left 1047499248 8:125429691-125429713 CCACGGCTCCAACCGGAGCTCCC No data
Right 1047499271 8:125429741-125429763 GGGGCGAAAGGCGTCGCCGCGGG No data
1047499247_1047499271 28 Left 1047499247 8:125429690-125429712 CCCACGGCTCCAACCGGAGCTCC No data
Right 1047499271 8:125429741-125429763 GGGGCGAAAGGCGTCGCCGCGGG No data
1047499258_1047499271 7 Left 1047499258 8:125429711-125429733 CCCCAGGCGCTGGGCGGTGGGGG No data
Right 1047499271 8:125429741-125429763 GGGGCGAAAGGCGTCGCCGCGGG No data
1047499253_1047499271 15 Left 1047499253 8:125429703-125429725 CCGGAGCTCCCCAGGCGCTGGGC No data
Right 1047499271 8:125429741-125429763 GGGGCGAAAGGCGTCGCCGCGGG No data
1047499260_1047499271 6 Left 1047499260 8:125429712-125429734 CCCAGGCGCTGGGCGGTGGGGGG No data
Right 1047499271 8:125429741-125429763 GGGGCGAAAGGCGTCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047499271 Original CRISPR GGGGCGAAAGGCGTCGCCGC GGG Intergenic
No off target data available for this crispr