ID: 1047499806

View in Genome Browser
Species Human (GRCh38)
Location 8:125431965-125431987
Sequence GAGACACAGCTCCTAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047499799_1047499806 9 Left 1047499799 8:125431933-125431955 CCTTTGAACATAGGGATCCCATC 0: 1
1: 0
2: 2
3: 12
4: 114
Right 1047499806 8:125431965-125431987 GAGACACAGCTCCTAGAAACAGG No data
1047499804_1047499806 -9 Left 1047499804 8:125431951-125431973 CCATCCAGGAGGAGGAGACACAG 0: 1
1: 2
2: 4
3: 55
4: 429
Right 1047499806 8:125431965-125431987 GAGACACAGCTCCTAGAAACAGG No data
1047499795_1047499806 24 Left 1047499795 8:125431918-125431940 CCAGCCAGCGATTTTCCTTTGAA 0: 1
1: 0
2: 2
3: 7
4: 143
Right 1047499806 8:125431965-125431987 GAGACACAGCTCCTAGAAACAGG No data
1047499796_1047499806 20 Left 1047499796 8:125431922-125431944 CCAGCGATTTTCCTTTGAACATA 0: 1
1: 0
2: 1
3: 24
4: 147
Right 1047499806 8:125431965-125431987 GAGACACAGCTCCTAGAAACAGG No data
1047499803_1047499806 -8 Left 1047499803 8:125431950-125431972 CCCATCCAGGAGGAGGAGACACA 0: 1
1: 0
2: 0
3: 19
4: 228
Right 1047499806 8:125431965-125431987 GAGACACAGCTCCTAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047499806 Original CRISPR GAGACACAGCTCCTAGAAAC AGG Intronic
No off target data available for this crispr