ID: 1047507052

View in Genome Browser
Species Human (GRCh38)
Location 8:125488260-125488282
Sequence CCATTTTACCAAAGGGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047507052_1047507058 1 Left 1047507052 8:125488260-125488282 CCGTCTGCCCTTTGGTAAAATGG No data
Right 1047507058 8:125488284-125488306 GATTGTCATTAACACACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047507052 Original CRISPR CCATTTTACCAAAGGGCAGA CGG (reversed) Intergenic
No off target data available for this crispr