ID: 1047507058

View in Genome Browser
Species Human (GRCh38)
Location 8:125488284-125488306
Sequence GATTGTCATTAACACACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047507052_1047507058 1 Left 1047507052 8:125488260-125488282 CCGTCTGCCCTTTGGTAAAATGG No data
Right 1047507058 8:125488284-125488306 GATTGTCATTAACACACCATTGG No data
1047507050_1047507058 21 Left 1047507050 8:125488240-125488262 CCTCAAAGCTCTCTGAGCTTCCG No data
Right 1047507058 8:125488284-125488306 GATTGTCATTAACACACCATTGG No data
1047507056_1047507058 -6 Left 1047507056 8:125488267-125488289 CCCTTTGGTAAAATGGGGATTGT No data
Right 1047507058 8:125488284-125488306 GATTGTCATTAACACACCATTGG No data
1047507057_1047507058 -7 Left 1047507057 8:125488268-125488290 CCTTTGGTAAAATGGGGATTGTC No data
Right 1047507058 8:125488284-125488306 GATTGTCATTAACACACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047507058 Original CRISPR GATTGTCATTAACACACCAT TGG Intergenic
No off target data available for this crispr