ID: 1047507570

View in Genome Browser
Species Human (GRCh38)
Location 8:125491833-125491855
Sequence CTGTGTCAGAGGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047507562_1047507570 -3 Left 1047507562 8:125491813-125491835 CCCTGAGAGGAGACAGCCTCCTG No data
Right 1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG No data
1047507563_1047507570 -4 Left 1047507563 8:125491814-125491836 CCTGAGAGGAGACAGCCTCCTGT No data
Right 1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG No data
1047507560_1047507570 21 Left 1047507560 8:125491789-125491811 CCTGGGGAGAAGGGCTTCATGCT No data
Right 1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG No data
1047507559_1047507570 22 Left 1047507559 8:125491788-125491810 CCCTGGGGAGAAGGGCTTCATGC No data
Right 1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047507570 Original CRISPR CTGTGTCAGAGGAGGCTGGA GGG Intergenic
No off target data available for this crispr