ID: 1047511719

View in Genome Browser
Species Human (GRCh38)
Location 8:125520797-125520819
Sequence CTTTGAATGCTAAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047511713_1047511719 -1 Left 1047511713 8:125520775-125520797 CCTTCTGCGGTACGCACTGGCCC No data
Right 1047511719 8:125520797-125520819 CTTTGAATGCTAAAGGTGGGTGG No data
1047511707_1047511719 16 Left 1047511707 8:125520758-125520780 CCAAATCCTAGAGTTCCCCTTCT No data
Right 1047511719 8:125520797-125520819 CTTTGAATGCTAAAGGTGGGTGG No data
1047511709_1047511719 10 Left 1047511709 8:125520764-125520786 CCTAGAGTTCCCCTTCTGCGGTA No data
Right 1047511719 8:125520797-125520819 CTTTGAATGCTAAAGGTGGGTGG No data
1047511711_1047511719 1 Left 1047511711 8:125520773-125520795 CCCCTTCTGCGGTACGCACTGGC No data
Right 1047511719 8:125520797-125520819 CTTTGAATGCTAAAGGTGGGTGG No data
1047511712_1047511719 0 Left 1047511712 8:125520774-125520796 CCCTTCTGCGGTACGCACTGGCC No data
Right 1047511719 8:125520797-125520819 CTTTGAATGCTAAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047511719 Original CRISPR CTTTGAATGCTAAAGGTGGG TGG Intergenic
No off target data available for this crispr