ID: 1047512070

View in Genome Browser
Species Human (GRCh38)
Location 8:125523019-125523041
Sequence CTGTGGGTAAGGATCTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047512070_1047512074 13 Left 1047512070 8:125523019-125523041 CCATACTAGATCCTTACCCACAG No data
Right 1047512074 8:125523055-125523077 AAGTATTTCAGACCTGCCAGAGG No data
1047512070_1047512075 21 Left 1047512070 8:125523019-125523041 CCATACTAGATCCTTACCCACAG No data
Right 1047512075 8:125523063-125523085 CAGACCTGCCAGAGGCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047512070 Original CRISPR CTGTGGGTAAGGATCTAGTA TGG (reversed) Intergenic
No off target data available for this crispr