ID: 1047513115

View in Genome Browser
Species Human (GRCh38)
Location 8:125530537-125530559
Sequence AAATGTTCTCAGATGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047513115_1047513117 -7 Left 1047513115 8:125530537-125530559 CCATGATCCATCTGAGAACATTT No data
Right 1047513117 8:125530553-125530575 AACATTTTCATTATCCCAAATGG 0: 2
1: 26
2: 154
3: 441
4: 932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047513115 Original CRISPR AAATGTTCTCAGATGGATCA TGG (reversed) Intergenic
No off target data available for this crispr