ID: 1047513115 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:125530537-125530559 |
| Sequence | AAATGTTCTCAGATGGATCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047513115_1047513117 | -7 | Left | 1047513115 | 8:125530537-125530559 | CCATGATCCATCTGAGAACATTT | No data | ||
| Right | 1047513117 | 8:125530553-125530575 | AACATTTTCATTATCCCAAATGG | 0: 2 1: 26 2: 154 3: 441 4: 932 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047513115 | Original CRISPR | AAATGTTCTCAGATGGATCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||