ID: 1047513745 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:125535651-125535673 |
| Sequence | TGGGACTACCTTGGAAAACC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047513739_1047513745 | 14 | Left | 1047513739 | 8:125535614-125535636 | CCAGACTCTTGAGAATGATGGAA | No data | ||
| Right | 1047513745 | 8:125535651-125535673 | TGGGACTACCTTGGAAAACCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047513745 | Original CRISPR | TGGGACTACCTTGGAAAACC TGG | Intergenic | ||
| No off target data available for this crispr | |||||