ID: 1047513745

View in Genome Browser
Species Human (GRCh38)
Location 8:125535651-125535673
Sequence TGGGACTACCTTGGAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047513739_1047513745 14 Left 1047513739 8:125535614-125535636 CCAGACTCTTGAGAATGATGGAA No data
Right 1047513745 8:125535651-125535673 TGGGACTACCTTGGAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047513745 Original CRISPR TGGGACTACCTTGGAAAACC TGG Intergenic
No off target data available for this crispr