ID: 1047521347

View in Genome Browser
Species Human (GRCh38)
Location 8:125597549-125597571
Sequence ATTCTAGCCACAAGAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047521347_1047521351 16 Left 1047521347 8:125597549-125597571 CCAGACTTTCTTGTGGCTAGAAT No data
Right 1047521351 8:125597588-125597610 TTCTATATGAAGATATAGGCTGG No data
1047521347_1047521353 22 Left 1047521347 8:125597549-125597571 CCAGACTTTCTTGTGGCTAGAAT No data
Right 1047521353 8:125597594-125597616 ATGAAGATATAGGCTGGGTGCGG No data
1047521347_1047521352 17 Left 1047521347 8:125597549-125597571 CCAGACTTTCTTGTGGCTAGAAT No data
Right 1047521352 8:125597589-125597611 TCTATATGAAGATATAGGCTGGG No data
1047521347_1047521350 12 Left 1047521347 8:125597549-125597571 CCAGACTTTCTTGTGGCTAGAAT No data
Right 1047521350 8:125597584-125597606 TAAGTTCTATATGAAGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047521347 Original CRISPR ATTCTAGCCACAAGAAAGTC TGG (reversed) Intergenic
No off target data available for this crispr