ID: 1047521349

View in Genome Browser
Species Human (GRCh38)
Location 8:125597575-125597597
Sequence TCATATAGAACTTAGTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047521349_1047521355 26 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521355 8:125597624-125597646 CGCCTGTAATCCCGGCACTTTGG 0: 983
1: 125512
2: 272609
3: 224919
4: 154711
1047521349_1047521358 30 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521358 8:125597628-125597650 TGTAATCCCGGCACTTTGGGAGG 0: 2670
1: 294815
2: 268411
3: 154339
4: 131866
1047521349_1047521353 -4 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521353 8:125597594-125597616 ATGAAGATATAGGCTGGGTGCGG No data
1047521349_1047521354 18 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521354 8:125597616-125597638 GTCGCTCACGCCTGTAATCCCGG No data
1047521349_1047521356 27 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521356 8:125597625-125597647 GCCTGTAATCCCGGCACTTTGGG 0: 1911
1: 221243
2: 273304
3: 186347
4: 142382
1047521349_1047521351 -10 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521351 8:125597588-125597610 TTCTATATGAAGATATAGGCTGG No data
1047521349_1047521352 -9 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521352 8:125597589-125597611 TCTATATGAAGATATAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047521349 Original CRISPR TCATATAGAACTTAGTCACT TGG (reversed) Intergenic
No off target data available for this crispr