ID: 1047521352 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:125597589-125597611 |
Sequence | TCTATATGAAGATATAGGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1047521347_1047521352 | 17 | Left | 1047521347 | 8:125597549-125597571 | CCAGACTTTCTTGTGGCTAGAAT | No data | ||
Right | 1047521352 | 8:125597589-125597611 | TCTATATGAAGATATAGGCTGGG | No data | ||||
1047521349_1047521352 | -9 | Left | 1047521349 | 8:125597575-125597597 | CCAAGTGACTAAGTTCTATATGA | No data | ||
Right | 1047521352 | 8:125597589-125597611 | TCTATATGAAGATATAGGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1047521352 | Original CRISPR | TCTATATGAAGATATAGGCT GGG | Intergenic | ||
No off target data available for this crispr |