ID: 1047521352

View in Genome Browser
Species Human (GRCh38)
Location 8:125597589-125597611
Sequence TCTATATGAAGATATAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047521347_1047521352 17 Left 1047521347 8:125597549-125597571 CCAGACTTTCTTGTGGCTAGAAT No data
Right 1047521352 8:125597589-125597611 TCTATATGAAGATATAGGCTGGG No data
1047521349_1047521352 -9 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521352 8:125597589-125597611 TCTATATGAAGATATAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047521352 Original CRISPR TCTATATGAAGATATAGGCT GGG Intergenic
No off target data available for this crispr