ID: 1047521354

View in Genome Browser
Species Human (GRCh38)
Location 8:125597616-125597638
Sequence GTCGCTCACGCCTGTAATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047521349_1047521354 18 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521354 8:125597616-125597638 GTCGCTCACGCCTGTAATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047521354 Original CRISPR GTCGCTCACGCCTGTAATCC CGG Intergenic
No off target data available for this crispr