ID: 1047521355

View in Genome Browser
Species Human (GRCh38)
Location 8:125597624-125597646
Sequence CGCCTGTAATCCCGGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 778734
Summary {0: 983, 1: 125512, 2: 272609, 3: 224919, 4: 154711}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047521349_1047521355 26 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521355 8:125597624-125597646 CGCCTGTAATCCCGGCACTTTGG 0: 983
1: 125512
2: 272609
3: 224919
4: 154711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047521355 Original CRISPR CGCCTGTAATCCCGGCACTT TGG Intergenic
Too many off-targets to display for this crispr