ID: 1047521356

View in Genome Browser
Species Human (GRCh38)
Location 8:125597625-125597647
Sequence GCCTGTAATCCCGGCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 825187
Summary {0: 1911, 1: 221243, 2: 273304, 3: 186347, 4: 142382}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047521349_1047521356 27 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521356 8:125597625-125597647 GCCTGTAATCCCGGCACTTTGGG 0: 1911
1: 221243
2: 273304
3: 186347
4: 142382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047521356 Original CRISPR GCCTGTAATCCCGGCACTTT GGG Intergenic
Too many off-targets to display for this crispr