ID: 1047521358

View in Genome Browser
Species Human (GRCh38)
Location 8:125597628-125597650
Sequence TGTAATCCCGGCACTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 852101
Summary {0: 2670, 1: 294815, 2: 268411, 3: 154339, 4: 131866}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047521349_1047521358 30 Left 1047521349 8:125597575-125597597 CCAAGTGACTAAGTTCTATATGA No data
Right 1047521358 8:125597628-125597650 TGTAATCCCGGCACTTTGGGAGG 0: 2670
1: 294815
2: 268411
3: 154339
4: 131866

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047521358 Original CRISPR TGTAATCCCGGCACTTTGGG AGG Intergenic
Too many off-targets to display for this crispr