ID: 1047521358 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:125597628-125597650 |
| Sequence | TGTAATCCCGGCACTTTGGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 852101 | |||
| Summary | {0: 2670, 1: 294815, 2: 268411, 3: 154339, 4: 131866} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047521349_1047521358 | 30 | Left | 1047521349 | 8:125597575-125597597 | CCAAGTGACTAAGTTCTATATGA | No data | ||
| Right | 1047521358 | 8:125597628-125597650 | TGTAATCCCGGCACTTTGGGAGG | 0: 2670 1: 294815 2: 268411 3: 154339 4: 131866 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047521358 | Original CRISPR | TGTAATCCCGGCACTTTGGG AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||