ID: 1047525601

View in Genome Browser
Species Human (GRCh38)
Location 8:125631756-125631778
Sequence CCTATTCAGCTCCAGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047525601_1047525611 24 Left 1047525601 8:125631756-125631778 CCACACTCCTGGAGCTGAATAGG No data
Right 1047525611 8:125631803-125631825 CATGATGGAAATTAGCAGGAAGG No data
1047525601_1047525606 9 Left 1047525601 8:125631756-125631778 CCACACTCCTGGAGCTGAATAGG No data
Right 1047525606 8:125631788-125631810 ACTTTCCCTGAACCTCATGATGG No data
1047525601_1047525609 20 Left 1047525601 8:125631756-125631778 CCACACTCCTGGAGCTGAATAGG No data
Right 1047525609 8:125631799-125631821 ACCTCATGATGGAAATTAGCAGG No data
1047525601_1047525612 25 Left 1047525601 8:125631756-125631778 CCACACTCCTGGAGCTGAATAGG No data
Right 1047525612 8:125631804-125631826 ATGATGGAAATTAGCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047525601 Original CRISPR CCTATTCAGCTCCAGGAGTG TGG (reversed) Intergenic
No off target data available for this crispr