ID: 1047525620

View in Genome Browser
Species Human (GRCh38)
Location 8:125631901-125631923
Sequence TAAAATAGGCATAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047525620_1047525625 -1 Left 1047525620 8:125631901-125631923 CCCTGCCCACTATGCCTATTTTA No data
Right 1047525625 8:125631923-125631945 AATGATGAAGAATGTTAAGCTGG No data
1047525620_1047525627 12 Left 1047525620 8:125631901-125631923 CCCTGCCCACTATGCCTATTTTA No data
Right 1047525627 8:125631936-125631958 GTTAAGCTGGGCTTTGAGCTTGG No data
1047525620_1047525626 0 Left 1047525620 8:125631901-125631923 CCCTGCCCACTATGCCTATTTTA No data
Right 1047525626 8:125631924-125631946 ATGATGAAGAATGTTAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047525620 Original CRISPR TAAAATAGGCATAGTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr