ID: 1047527019

View in Genome Browser
Species Human (GRCh38)
Location 8:125642167-125642189
Sequence CTGTGGGAGCACAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047527019_1047527024 4 Left 1047527019 8:125642167-125642189 CCTCCTTCCTTGTGCTCCCACAG No data
Right 1047527024 8:125642194-125642216 ATGCATCCTTCTTAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047527019 Original CRISPR CTGTGGGAGCACAAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr