ID: 1047536590

View in Genome Browser
Species Human (GRCh38)
Location 8:125725665-125725687
Sequence GCCCTGGGAGTAAAACCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047536585_1047536590 2 Left 1047536585 8:125725640-125725662 CCACTTTCCTTCAGAGCCAGGGA No data
Right 1047536590 8:125725665-125725687 GCCCTGGGAGTAAAACCATTTGG No data
1047536586_1047536590 -5 Left 1047536586 8:125725647-125725669 CCTTCAGAGCCAGGGACTGCCCT No data
Right 1047536590 8:125725665-125725687 GCCCTGGGAGTAAAACCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047536590 Original CRISPR GCCCTGGGAGTAAAACCATT TGG Intergenic
No off target data available for this crispr