ID: 1047536628

View in Genome Browser
Species Human (GRCh38)
Location 8:125726149-125726171
Sequence TTGAATAAACATGAAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047536628_1047536631 9 Left 1047536628 8:125726149-125726171 CCTTCCTTTTCATGTTTATTCAA No data
Right 1047536631 8:125726181-125726203 CATTCTACAAGCTCTTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047536628 Original CRISPR TTGAATAAACATGAAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr