ID: 1047536866

View in Genome Browser
Species Human (GRCh38)
Location 8:125727871-125727893
Sequence AGATGCACCATGCACATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047536866_1047536870 4 Left 1047536866 8:125727871-125727893 CCTCAAATGTGCATGGTGCATCT No data
Right 1047536870 8:125727898-125727920 GTAAGGGCCGCTCTATTACTGGG No data
1047536866_1047536873 28 Left 1047536866 8:125727871-125727893 CCTCAAATGTGCATGGTGCATCT No data
Right 1047536873 8:125727922-125727944 TCTGAATTCTCCAGGTGTTCTGG No data
1047536866_1047536872 20 Left 1047536866 8:125727871-125727893 CCTCAAATGTGCATGGTGCATCT No data
Right 1047536872 8:125727914-125727936 TACTGGGTTCTGAATTCTCCAGG No data
1047536866_1047536869 3 Left 1047536866 8:125727871-125727893 CCTCAAATGTGCATGGTGCATCT No data
Right 1047536869 8:125727897-125727919 AGTAAGGGCCGCTCTATTACTGG No data
1047536866_1047536874 29 Left 1047536866 8:125727871-125727893 CCTCAAATGTGCATGGTGCATCT No data
Right 1047536874 8:125727923-125727945 CTGAATTCTCCAGGTGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047536866 Original CRISPR AGATGCACCATGCACATTTG AGG (reversed) Intergenic
No off target data available for this crispr