ID: 1047537584

View in Genome Browser
Species Human (GRCh38)
Location 8:125733774-125733796
Sequence GGGATGCTAATGCCTCTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047537582_1047537584 -8 Left 1047537582 8:125733759-125733781 CCACATCTGTAAAATGGGATGCT No data
Right 1047537584 8:125733774-125733796 GGGATGCTAATGCCTCTTTAGGG No data
1047537579_1047537584 9 Left 1047537579 8:125733742-125733764 CCGCTAAGCTTCAGCTTCCACAT No data
Right 1047537584 8:125733774-125733796 GGGATGCTAATGCCTCTTTAGGG No data
1047537577_1047537584 23 Left 1047537577 8:125733728-125733750 CCTTGTGCTAAGTCCCGCTAAGC No data
Right 1047537584 8:125733774-125733796 GGGATGCTAATGCCTCTTTAGGG No data
1047537578_1047537584 10 Left 1047537578 8:125733741-125733763 CCCGCTAAGCTTCAGCTTCCACA No data
Right 1047537584 8:125733774-125733796 GGGATGCTAATGCCTCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047537584 Original CRISPR GGGATGCTAATGCCTCTTTA GGG Intergenic
No off target data available for this crispr