ID: 1047541281

View in Genome Browser
Species Human (GRCh38)
Location 8:125768781-125768803
Sequence CGCTCCCTCCCCAAACCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047541281_1047541284 -9 Left 1047541281 8:125768781-125768803 CCACAGGGTTTGGGGAGGGAGCG No data
Right 1047541284 8:125768795-125768817 GAGGGAGCGCTCCAGTTGGTGGG No data
1047541281_1047541288 4 Left 1047541281 8:125768781-125768803 CCACAGGGTTTGGGGAGGGAGCG No data
Right 1047541288 8:125768808-125768830 AGTTGGTGGGGAGCTAATTAGGG No data
1047541281_1047541283 -10 Left 1047541281 8:125768781-125768803 CCACAGGGTTTGGGGAGGGAGCG No data
Right 1047541283 8:125768794-125768816 GGAGGGAGCGCTCCAGTTGGTGG No data
1047541281_1047541289 15 Left 1047541281 8:125768781-125768803 CCACAGGGTTTGGGGAGGGAGCG No data
Right 1047541289 8:125768819-125768841 AGCTAATTAGGGCCAGTAACTGG No data
1047541281_1047541285 -8 Left 1047541281 8:125768781-125768803 CCACAGGGTTTGGGGAGGGAGCG No data
Right 1047541285 8:125768796-125768818 AGGGAGCGCTCCAGTTGGTGGGG No data
1047541281_1047541287 3 Left 1047541281 8:125768781-125768803 CCACAGGGTTTGGGGAGGGAGCG No data
Right 1047541287 8:125768807-125768829 CAGTTGGTGGGGAGCTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047541281 Original CRISPR CGCTCCCTCCCCAAACCCTG TGG (reversed) Intergenic
No off target data available for this crispr