ID: 1047542843

View in Genome Browser
Species Human (GRCh38)
Location 8:125787111-125787133
Sequence GGTCCCAAGAAAGCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047542843_1047542846 15 Left 1047542843 8:125787111-125787133 CCTGCTTTTGCTTTCTTGGGACC No data
Right 1047542846 8:125787149-125787171 AGAAATTCAGATTACATTACTGG No data
1047542843_1047542849 30 Left 1047542843 8:125787111-125787133 CCTGCTTTTGCTTTCTTGGGACC No data
Right 1047542849 8:125787164-125787186 ATTACTGGAGAAAGCATGTGGGG No data
1047542843_1047542848 29 Left 1047542843 8:125787111-125787133 CCTGCTTTTGCTTTCTTGGGACC No data
Right 1047542848 8:125787163-125787185 CATTACTGGAGAAAGCATGTGGG No data
1047542843_1047542847 28 Left 1047542843 8:125787111-125787133 CCTGCTTTTGCTTTCTTGGGACC No data
Right 1047542847 8:125787162-125787184 ACATTACTGGAGAAAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047542843 Original CRISPR GGTCCCAAGAAAGCAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr