ID: 1047544827

View in Genome Browser
Species Human (GRCh38)
Location 8:125805336-125805358
Sequence CTAGTTTTTCAGGTTTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1908
Summary {0: 22, 1: 42, 2: 124, 3: 404, 4: 1316}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047544827_1047544832 -7 Left 1047544827 8:125805336-125805358 CCCAAAGAAACCTGAAAAACTAG 0: 22
1: 42
2: 124
3: 404
4: 1316
Right 1047544832 8:125805352-125805374 AAACTAGTTCAGGCCATGATGGG 0: 130
1: 272
2: 382
3: 367
4: 354
1047544827_1047544835 1 Left 1047544827 8:125805336-125805358 CCCAAAGAAACCTGAAAAACTAG 0: 22
1: 42
2: 124
3: 404
4: 1316
Right 1047544835 8:125805360-125805382 TCAGGCCATGATGGGAAGGGAGG 0: 24
1: 143
2: 238
3: 358
4: 685
1047544827_1047544836 5 Left 1047544827 8:125805336-125805358 CCCAAAGAAACCTGAAAAACTAG 0: 22
1: 42
2: 124
3: 404
4: 1316
Right 1047544836 8:125805364-125805386 GCCATGATGGGAAGGGAGGTCGG No data
1047544827_1047544833 -3 Left 1047544827 8:125805336-125805358 CCCAAAGAAACCTGAAAAACTAG 0: 22
1: 42
2: 124
3: 404
4: 1316
Right 1047544833 8:125805356-125805378 TAGTTCAGGCCATGATGGGAAGG 0: 70
1: 139
2: 167
3: 171
4: 236
1047544827_1047544831 -8 Left 1047544827 8:125805336-125805358 CCCAAAGAAACCTGAAAAACTAG 0: 22
1: 42
2: 124
3: 404
4: 1316
Right 1047544831 8:125805351-125805373 AAAACTAGTTCAGGCCATGATGG 0: 148
1: 300
2: 379
3: 331
4: 380
1047544827_1047544834 -2 Left 1047544827 8:125805336-125805358 CCCAAAGAAACCTGAAAAACTAG 0: 22
1: 42
2: 124
3: 404
4: 1316
Right 1047544834 8:125805357-125805379 AGTTCAGGCCATGATGGGAAGGG 0: 82
1: 145
2: 184
3: 187
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047544827 Original CRISPR CTAGTTTTTCAGGTTTCTTT GGG (reversed) Intergenic
900173206 1:1280699-1280721 CTAGTTTTTCAGGTTAACTTTGG + Intronic
900434279 1:2620878-2620900 CTCGTTTTTCAGGTTAACTTTGG - Intronic
900734546 1:4289152-4289174 CTTGTTTTTCTAGTTGCTTTAGG + Intergenic
900813302 1:4824716-4824738 CTATTTTTTCAGGGTTCTGTGGG + Intergenic
900847149 1:5113078-5113100 CTAGTTTTTCAGGTTGACTCTGG + Intergenic
902174167 1:14636960-14636982 ATAGCTTTTAAGGTTTCCTTTGG - Intronic
902738467 1:18417253-18417275 GTAGTTTTTCAGGTTAACTTTGG + Intergenic
902978399 1:20106072-20106094 CTAGTTTTTCAGGCTAACTTTGG + Intergenic
902997406 1:20237481-20237503 GCAGTTTTTAAGGTTTCTCTGGG - Intergenic
902997616 1:20239039-20239061 CTAGTTTTTCAGGTTAACTTGGG - Intergenic
903054765 1:20627963-20627985 CTACTTTTTCAGGTTAACTTTGG - Intergenic
903055176 1:20631340-20631362 TTAGTTTTTTAGGTTTTCTTTGG + Intergenic
903131776 1:21284213-21284235 CTGGTTTCTTACGTTTCTTTTGG + Intronic
903309560 1:22443957-22443979 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
903519228 1:23934825-23934847 CTAATTTTTCAGGTTAACTTTGG + Intergenic
904324688 1:29720733-29720755 CTGGTTTTTCACGGTTCTGTAGG + Intergenic
904519580 1:31084420-31084442 CCAGTTTTTAAGGGTTCTCTTGG - Intergenic
904712135 1:32438198-32438220 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
904761989 1:32811934-32811956 CTAGTTTTTTAAGTTTCTTTGGG - Intronic
904951596 1:34245488-34245510 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
904951889 1:34249094-34249116 CTACTTTTTTTGTTTTCTTTTGG + Intergenic
905053376 1:35072606-35072628 CTTGTTTTTCTAGTTTCTTGAGG + Intronic
905193901 1:36258855-36258877 CTTGTTTTTCCTGTTTGTTTTGG + Intronic
905738393 1:40347946-40347968 CTATTTTTTCAAATTTATTTTGG + Intronic
905991431 1:42340488-42340510 CCAGAGTTTCAGGTTCCTTTGGG - Intergenic
906053729 1:42897579-42897601 ATGGTTTTGAAGGTTTCTTTAGG + Intergenic
906218762 1:44060698-44060720 CAAGTTCTTTAGGGTTCTTTAGG - Intergenic
906585537 1:46973979-46974001 TTTGTTTTTCAAGTTTCTCTAGG + Intergenic
906821674 1:48936436-48936458 CTGGCTTTTCATGTCTCTTTTGG - Intronic
906925831 1:50115393-50115415 CTAGTTTTGCATTTTACTTTTGG - Intronic
907147624 1:52250064-52250086 GTAGTTTGTCAGGATTATTTTGG + Intronic
907626080 1:56031080-56031102 CTAGATTCTCAGCTTCCTTTGGG + Intergenic
907971208 1:59383484-59383506 CTGGTTTTTCAGGTTAAATTTGG - Intronic
908095191 1:60730165-60730187 CTAGTTTTCCAGATTTACTTTGG - Intergenic
908215884 1:61951367-61951389 GTAGTATTTGAGTTTTCTTTGGG + Intronic
908228912 1:62084688-62084710 CTAGTTGTTGAGGTTAATTTTGG + Intronic
908309689 1:62867198-62867220 ATAGTTTTTCATGATTATTTAGG - Intergenic
908352326 1:63298612-63298634 CTTGTTTATCATGTTTTTTTTGG + Intergenic
908496550 1:64700339-64700361 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
908629838 1:66091110-66091132 ACAGTTTTTCTAGTTTCTTTAGG + Intronic
908672254 1:66561029-66561051 CTAATCTTTCAGGGTTGTTTGGG - Intronic
908864662 1:68533415-68533437 CTTGTTTTTCTAGTTTCTCTAGG - Intergenic
908867315 1:68563852-68563874 CTTGTTTTTCTAGTTCCTTTAGG + Intergenic
909036327 1:70597883-70597905 CTAGATTTTCTAGTTTATTTGGG + Intergenic
909051768 1:70775437-70775459 TTAGTTTTTCAGGTTTCTTTGGG - Intergenic
909104914 1:71395040-71395062 CTATTTGTTCAGATTCCTTTAGG + Intergenic
909158143 1:72107472-72107494 CAAGTTTGTTATGTTTCTTTTGG + Intronic
909194916 1:72607088-72607110 CTAGTTTTTCTGGTTTTCTTTGG - Intergenic
909232025 1:73103267-73103289 CTTTTTTTTCTGGTTCCTTTAGG - Intergenic
909633284 1:77788860-77788882 CTTCTTTTTCAAGTTTATTTTGG + Intronic
909684199 1:78328409-78328431 CTAGATTTTCGGGTTTACTTTGG - Intronic
909830474 1:80182951-80182973 ATAGTTTTGAAGGTTCCTTTTGG + Intergenic
909989606 1:82207043-82207065 CTGCTTTTTCTGCTTTCTTTTGG - Intergenic
909993687 1:82253285-82253307 CTAGATTTTCTAGTTTATTTGGG - Intergenic
910025746 1:82648803-82648825 CTTCTTTTTCAAGTTTCTTAAGG - Intergenic
910067475 1:83170797-83170819 CTAGATTTTCTAGTTTATTTGGG - Intergenic
910068730 1:83185415-83185437 CTAGATTTTCTAGTTTATTTGGG - Intergenic
910075016 1:83266843-83266865 CTAGATTTTCTAGTTTATTTGGG - Intergenic
910081008 1:83341400-83341422 CTAGATTTTCTAGTTTATTTGGG - Intergenic
910082049 1:83353200-83353222 CTAGATTTTCTAGTTTATTTGGG + Intergenic
910195992 1:84640179-84640201 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
910720791 1:90284341-90284363 CTAGATTTTTTGCTTTCTTTGGG + Intergenic
910796976 1:91107268-91107290 CCACTTATTTAGGTTTCTTTGGG + Intergenic
910880318 1:91917296-91917318 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
911646103 1:100338511-100338533 CTAGTTTTTCAGGTTAACTATGG + Intergenic
911667870 1:100574613-100574635 TTATTTTTTGAGTTTTCTTTGGG + Intergenic
911686741 1:100786121-100786143 TCAGTTTTTAAGGTTTCTCTAGG + Intergenic
911823346 1:102447447-102447469 GCAGTTTTTCATGTGTCTTTTGG - Intergenic
911852686 1:102838950-102838972 GTAGTTTCTCAGCTTTCTGTTGG - Intergenic
911991167 1:104698506-104698528 CCATTTTTTCATGTGTCTTTTGG - Intergenic
912110468 1:106334753-106334775 CCATTTTTTCATGTGTCTTTTGG - Intergenic
912896973 1:113602303-113602325 ATAGTTTTTAGGGTTCCTTTAGG - Intronic
912940247 1:114038491-114038513 ATAGTTTTTCAGGCTAATTTTGG - Intergenic
913023475 1:114810473-114810495 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
913401199 1:118435447-118435469 CTTCTTTTTCTGGTTTCTTAAGG + Intergenic
913403199 1:118458964-118458986 CTTGTTTTTCTAGTTTCTTGAGG + Intergenic
913414322 1:118588763-118588785 CTAGTTTTTCAGGTTAACTCTGG + Intergenic
913652639 1:120933058-120933080 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
913669092 1:121078598-121078620 CTAGTTTTTCAGGTTCACTTTGG - Intergenic
914020837 1:143866003-143866025 CTAGTTTTTCAGGTTCACTTTGG - Intergenic
914080955 1:144411163-144411185 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
914168460 1:145195991-145196013 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
914175870 1:145279694-145279716 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
914202723 1:145500798-145500820 CTTGTTTTTCTAGTTTCTCTAGG - Intergenic
914236653 1:145818726-145818748 CTTGTTTTTCTAGTTTCTCTAGG - Intronic
914267133 1:146047883-146047905 CTAGTTTTTCAGGTTAACTGTGG - Intergenic
914481846 1:148073949-148073971 CTTGTTTTTCTAGTTTCTCTAGG - Intergenic
914530589 1:148521179-148521201 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
914642823 1:149627179-149627201 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
914659335 1:149773945-149773967 CTAGTTTTTCAGGTTCACTTTGG - Intergenic
914886898 1:151592878-151592900 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
915045854 1:153015018-153015040 CTTATTTTTCAAGATTCTTTTGG + Intergenic
915074256 1:153295852-153295874 CTAGATTTTCAGGTTTCCTTTGG - Intergenic
915453927 1:156026388-156026410 CCATTTTTTCAAGTTTCTGTAGG - Intergenic
915632370 1:157162506-157162528 CTAGATTTTCAGGTTTACTTCGG + Intergenic
915644333 1:157257281-157257303 CTAGATTTTCTAGTTTATTTGGG - Intergenic
916301260 1:163276891-163276913 CTAGTTTCTCAGGTTAATTTTGG - Intronic
916386425 1:164276790-164276812 GTCGTTTTTCAGTTTTCTTAAGG + Intergenic
916543935 1:165784396-165784418 CTAGTTTTTCAAGTTCACTTTGG + Intronic
916615229 1:166432444-166432466 CTAGTTTGTCACGTTTCACTTGG + Intergenic
916801363 1:168219656-168219678 CTAGATTTTCAGGTTAACTTTGG + Intergenic
916899421 1:169204163-169204185 TTAGCTTTTAAGGTTTCTCTGGG + Intronic
916951135 1:169781504-169781526 CTAGTTTTTCAGGTTTACTTTGG - Intronic
917057666 1:171001547-171001569 GTGGTTTTGAAGGTTTCTTTTGG + Intronic
917064091 1:171072973-171072995 CAAGTCTTTAAGGTTTCTTCGGG - Intergenic
917098008 1:171418871-171418893 CTAGTTTTTCAGGATAACTTTGG + Intergenic
917150867 1:171943316-171943338 CTAGTTTCTCAGGTTAACTTTGG - Intronic
917198356 1:172490273-172490295 CCAGTTTTTAAGGTTTCTCTGGG + Intergenic
917257042 1:173126678-173126700 CTAGTTTCTGAGGTTTACTTTGG + Intergenic
917308325 1:173650856-173650878 GTATTTTTTCATGTGTCTTTTGG + Intronic
917458412 1:175205683-175205705 CTAGTTTTTCAGATTAACTTTGG + Intergenic
917527139 1:175798268-175798290 CTACATTTTCAAGATTCTTTTGG - Intergenic
917530775 1:175833123-175833145 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
917907752 1:179604677-179604699 ATGGTTTTTAAGGTTCCTTTTGG + Intronic
918210871 1:182349748-182349770 CAAGTTTTTCCTGTTTTTTTTGG - Intergenic
918350914 1:183654733-183654755 CTCATTTTTCCTGTTTCTTTAGG - Intronic
918437510 1:184531600-184531622 TTAGTTTTCCATTTTTCTTTTGG + Intronic
918572361 1:186012377-186012399 CTAATCCTTCAGGTTTTTTTTGG + Intronic
918747006 1:188215592-188215614 CTTGTTTTTCAAGTTACTTTAGG + Intergenic
918802539 1:188990237-188990259 CTAGTTTTTCAGATTTCTTTGGG - Intergenic
919074923 1:192801602-192801624 ATATTTTTTCAGAATTCTTTTGG - Intergenic
919115270 1:193273766-193273788 ATAGTTTTGAAGGTTCCTTTTGG + Intergenic
919190747 1:194214915-194214937 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
919281297 1:195493043-195493065 ATAGTTTTGAAGGTTCCTTTTGG + Intergenic
919430915 1:197490361-197490383 ATAGTTTTGTGGGTTTCTTTTGG - Intergenic
919503550 1:198368961-198368983 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
919578718 1:199344086-199344108 CAAGTATATCAGCTTTCTTTTGG + Intergenic
919596543 1:199570772-199570794 CCAGTCTTTCAGGTTAATTTTGG - Intergenic
919675612 1:200379412-200379434 AGAGTTTTTCATATTTCTTTTGG - Intergenic
920105728 1:203552053-203552075 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
920608754 1:207416477-207416499 CTTGTTTTTCTGCTTTCTTTTGG - Intergenic
920795284 1:209131047-209131069 CTAGTTTTCCAGGTTTCCTTGGG - Intergenic
920810053 1:209276318-209276340 CTTGTTTTTCTAGTTCCTTTAGG + Intergenic
921176954 1:212604075-212604097 ATAGTTTTAAAGATTTCTTTGGG - Intronic
921236924 1:213141686-213141708 CTTGTTTTTCAGGTTTCTCTAGG + Intronic
921440405 1:215179429-215179451 CTTGTTTTTCTAGTTCCTTTAGG + Intronic
921665854 1:217869788-217869810 CTAGTTTTTCAGGTTAACTTTGG + Exonic
921717608 1:218434411-218434433 CTAGTTCTTCACTTTTATTTGGG - Exonic
921776065 1:219101651-219101673 CTAGTTTTTCAGATTTTTTTTGG - Intergenic
921901705 1:220457923-220457945 TCAGTTTTTCAGGTTTCTATGGG + Intergenic
921903991 1:220476678-220476700 CTCGTTGTAAAGGTTTCTTTGGG + Intergenic
921927878 1:220727752-220727774 AATGTTTTCCAGGTTTCTTTGGG - Intergenic
922152744 1:223019345-223019367 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
922237137 1:223730746-223730768 CTTGTTTTTCAGGTTTACCTTGG + Intronic
922363971 1:224846555-224846577 TTAGTGTTTCAGATTTCTCTGGG - Intergenic
922380568 1:225019939-225019961 CTTGTTTTTCTGGTTCCTCTAGG - Intronic
922683640 1:227621759-227621781 TTAGTTTTTCAGGTTTCATTGGG - Intronic
922700225 1:227754993-227755015 CTAGTTTTTCAGGATTACTTTGG - Intronic
922878468 1:228960416-228960438 TCAGTTTTTCAGGTTTCTCATGG + Intergenic
922895088 1:229093730-229093752 CTGGTTTTTCTGGTTTCTTTGGG - Intergenic
923067112 1:230528089-230528111 TAAGCTTTTCAGATTTCTTTGGG + Intergenic
923076004 1:230609102-230609124 CTAGTTTTTCAGGTTTTATTGGG + Intergenic
923328800 1:232903553-232903575 CTACCTTTTCAGGTTTACTTTGG + Intergenic
923407504 1:233677468-233677490 CTAGTGTTTCAGGTTAACTTTGG + Intergenic
923476662 1:234339758-234339780 CTTGTTTTTCAAGATTGTTTTGG - Intergenic
923769827 1:236928757-236928779 CTAGTTTTTCAGGTTCACTTTGG - Intergenic
923779482 1:237009400-237009422 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
923803866 1:237237415-237237437 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
923817603 1:237398174-237398196 TCAGTTTTTCAGGTTTCTCTGGG + Intronic
924066122 1:240223748-240223770 CTAGATTTTCTAGTTTATTTGGG + Intronic
924134711 1:240951569-240951591 TCAGTTTTTGAGGTTTCTGTTGG - Intronic
924262621 1:242247660-242247682 TCAGTTTTTCAGGTTTTTTGGGG + Intronic
924272612 1:242349411-242349433 CTAGTTTTTCAGGTTACCTTCGG + Intronic
924682945 1:246256727-246256749 CTTGTTTTTCTAGTTCCTTTAGG + Intronic
924920159 1:248620525-248620547 CTAGTTTATCAGGTTAACTTTGG - Intergenic
1062803578 10:397850-397872 CTGGTTTTTCAGGTTAACTTTGG - Intronic
1062824995 10:560769-560791 CTAGTTTTTCAGGTTAGCTTTGG - Intronic
1063102678 10:2964003-2964025 TGAGTTTTTCAGGTTTACTTTGG - Intergenic
1063282369 10:4644429-4644451 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1063756839 10:9020825-9020847 TTACTTTTACAGGTTTCCTTTGG + Intergenic
1063848529 10:10159768-10159790 CTAGTTTTTCAGGTTAATTTTGG + Intergenic
1063886963 10:10589438-10589460 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1063931201 10:11029965-11029987 CTCGTTTTTCAGGTCTCCTAAGG + Intronic
1063940859 10:11127654-11127676 GTATTTTTTCATGTGTCTTTTGG + Intronic
1063966112 10:11347174-11347196 TGAGTTTTTCAGGTTTCTTTGGG + Intergenic
1064098806 10:12445240-12445262 CTAGTCTTTCAGGTTAACTTTGG + Intronic
1064160708 10:12943322-12943344 CTAGTTTTTCACATTTCTTCGGG - Intronic
1064184825 10:13152479-13152501 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1064520207 10:16192986-16193008 CTAGTTTTTCATGTTTATTGTGG - Intergenic
1064694061 10:17948172-17948194 TCAGTTTTTAAGGTTTCTCTTGG - Intergenic
1064804791 10:19118719-19118741 CTAGTTTTACAGGTTAACTTCGG + Intronic
1064939104 10:20712991-20713013 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1064969257 10:21047675-21047697 ATAGTTGTTCAGGTTATTTTAGG - Intronic
1065006682 10:21386924-21386946 CTAGTTTTTCAGGTTAATTTTGG - Intergenic
1065012519 10:21432438-21432460 CTAGTTTTTCGGGTTAACTTTGG + Intergenic
1065058145 10:21868775-21868797 CTAGTTTTTCAAGTTTTCTTTGG - Intronic
1065074750 10:22066083-22066105 GCAGTTTTTCACGTGTCTTTTGG - Intergenic
1065114763 10:22474440-22474462 CCAGTTTGTCTGGTTTCTTAAGG + Intergenic
1065365651 10:24934377-24934399 CGAGTTTTTCAGGTTAACTTTGG - Intronic
1065456146 10:25908653-25908675 CCAGTTTTTCAGGTTTCTTTGGG + Intergenic
1065493886 10:26309469-26309491 CTAGTTTTTCAGGTTAGGTTTGG + Intergenic
1065609778 10:27461642-27461664 TCAGTTTTTCAGATTTCTCTGGG + Intergenic
1065696530 10:28385714-28385736 AGAGTTTTTCAAGTTTCTCTGGG + Intergenic
1065801631 10:29357769-29357791 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
1065838859 10:29683515-29683537 CTAGTTATTCAGGTTAATTTTGG + Intronic
1065839111 10:29685817-29685839 CTAATTTTTCAGGTTTTGTTGGG + Intronic
1065899470 10:30192271-30192293 CTTATTATTCAGGTTTTTTTTGG + Intergenic
1066192888 10:33071978-33072000 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1066209926 10:33226549-33226571 CTAGTTTTTCAGGTTAGCTTTGG - Intronic
1066290660 10:34011737-34011759 CTAGTTTTTTGGGTTTGCTTTGG - Intergenic
1066403207 10:35094888-35094910 CTAGGATTTGAGGTTTGTTTGGG - Intergenic
1066560711 10:36667002-36667024 CTTGTTTTTCTAGTTTCTTGAGG - Intergenic
1066974260 10:42350901-42350923 TTTGTTTTTCAGGTTTTTTAAGG - Intergenic
1067341473 10:45408700-45408722 CTAATTTTTCAGGTTAACTTTGG + Intronic
1067395363 10:45911535-45911557 CTAGTGTTTCAGGTTAACTTTGG - Intergenic
1067498822 10:46784209-46784231 CTAGTTTTCCAGTTTTCCTGAGG + Intergenic
1067595824 10:47556165-47556187 CTAGTTTTCCAGTTTTCCTGAGG - Intergenic
1067863683 10:49880656-49880678 CTAGTGTTTCAGGTTAACTTTGG - Intronic
1067895245 10:50172338-50172360 GTAGTCTTGAAGGTTTCTTTTGG - Intergenic
1067953738 10:50769640-50769662 GTAGTCTTGAAGGTTTCTTTTGG + Intronic
1068047561 10:51907110-51907132 CTAGTTTTTCAGGTTTACTTTGG + Intronic
1068137838 10:52967991-52968013 CTACCTTTTCAGGTTTCCTTGGG + Intergenic
1068197187 10:53732045-53732067 CTAGATTTTCAGGTTTATTTCGG + Intergenic
1068205194 10:53841367-53841389 CTATATTTTGAGGTTTTTTTAGG + Intronic
1068469741 10:57446239-57446261 CTAGATTTTCTAGTTTATTTAGG + Intergenic
1068602894 10:58974355-58974377 CTCATTTTTCAGGTTTACTTTGG - Intergenic
1068718915 10:60220357-60220379 GTAGTTTTGCAGGTTAATTTTGG - Intronic
1068830191 10:61485069-61485091 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1068889860 10:62137340-62137362 CTAGTTTTTCAGTATAATTTGGG + Intergenic
1068930737 10:62586571-62586593 ATAGTTTTTCAGGCTTCCCTAGG - Intronic
1068988009 10:63124637-63124659 TCAGTTTTTAAGGTTTCTGTGGG + Intergenic
1069134947 10:64752358-64752380 ATAGTGTTTCAGGTTTCTTTGGG + Intergenic
1069423922 10:68272922-68272944 CTAGTTTTTCAGGTTAAGTTTGG - Intergenic
1069732399 10:70625871-70625893 TGAGTTTTTCAGGTTTCCCTAGG - Intergenic
1069966909 10:72126844-72126866 CTTGTTTTTGAGGTAGCTTTGGG - Intronic
1070199002 10:74185355-74185377 CTATTTTTTCTGCTTTCTATTGG - Intronic
1070333934 10:75438098-75438120 CCTGATATTCAGGTTTCTTTTGG + Intronic
1070896440 10:79986423-79986445 CTAGTTTTTGTGCTTTCTTTTGG - Intergenic
1070896883 10:79991759-79991781 CTTGTTTTTCTAGTTTCTCTAGG + Intergenic
1070956509 10:80467248-80467270 GCTGTTTTTCAGGTTTCTCTGGG + Intronic
1070974292 10:80593149-80593171 CTTCTTTTTCAGGATTATTTTGG + Intronic
1071012102 10:80951573-80951595 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1071198881 10:83194486-83194508 CTCATTTCTCAGGTTTCTTTGGG - Intergenic
1071420332 10:85490242-85490264 GTATTTTTTCAGGTTTATTGAGG - Intergenic
1071772651 10:88746699-88746721 CTTGTTTTTCTAGTTTCTCTAGG - Intronic
1071863026 10:89695470-89695492 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1071925772 10:90407382-90407404 CTAGTTTTTCAGGTTAGTTTTGG - Intergenic
1071959477 10:90796148-90796170 CTGGTTTTTCAGGTTAACTTTGG + Intronic
1071962128 10:90817213-90817235 TCAGCTTTTCAGGTTTCTCTGGG - Intronic
1072700235 10:97635383-97635405 ATAGTTTTTCAGGTTAATTTAGG + Intronic
1072883448 10:99250940-99250962 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
1073541611 10:104319803-104319825 CTGGTTTTTAAGGTTTATTTTGG - Intronic
1073543739 10:104332499-104332521 CTAGTTTTTCATCTTTCTTCAGG + Intronic
1073707124 10:105997330-105997352 TTATTTTTTCAGGTTTATTGAGG + Intergenic
1073892079 10:108113524-108113546 TTAGGTTTTTGGGTTTCTTTGGG + Intergenic
1073936397 10:108637659-108637681 TCAGGTTTTCAGGTTTATTTTGG - Intergenic
1074466623 10:113688710-113688732 ATAGTTTTGAGGGTTTCTTTTGG + Intronic
1074474827 10:113761653-113761675 GTAGTTTTTGGGGATTCTTTGGG + Intronic
1074572388 10:114635877-114635899 CTCATTCTCCAGGTTTCTTTTGG - Intronic
1074635458 10:115311110-115311132 ATAGTTTTGAAGGTTCCTTTTGG + Intronic
1074799103 10:116980953-116980975 CTAGTTTTCAAGGATTATTTTGG - Intronic
1075234840 10:120718211-120718233 CTAGTTTTCCAGGTTTAGTTGGG - Intergenic
1075243631 10:120800689-120800711 ATAGTTTTTCGGGTTTGCTTTGG - Intergenic
1075386257 10:122057494-122057516 TTAGTTTTTAAGGCTTCTTTAGG - Intronic
1075805067 10:125181714-125181736 CTAGTTTTTCTAGTTTATTTGGG + Intergenic
1076459778 10:130633949-130633971 TCAGTTTTTCAAGTTTCTGTGGG + Intergenic
1076822902 10:132949830-132949852 CTAGGTTTTCAGGTTAACTTTGG + Intergenic
1076823009 10:132951017-132951039 CCAGTTTTTCAGGTTTCCTGGGG + Intergenic
1076832510 10:133003384-133003406 CTGGTTTTTTAGGTTTACTTTGG + Intergenic
1076997570 11:306192-306214 TCAGTTTTTCAGGTTTGTTTGGG + Intergenic
1077657718 11:4037897-4037919 CTACCTTTTCTGCTTTCTTTTGG + Intronic
1077661266 11:4070569-4070591 GAAGGTTTTGAGGTTTCTTTGGG - Intronic
1077671343 11:4160525-4160547 CTAGCTTTTCAGGTTTCTTTGGG + Intergenic
1077885064 11:6381369-6381391 CTAGATTTTCTGGTTTAGTTTGG - Intergenic
1077964110 11:7109300-7109322 ATAGTTTTGATGGTTTCTTTTGG + Intergenic
1078029175 11:7731389-7731411 CTTGTTTTTCAAGATTGTTTTGG + Intergenic
1078046540 11:7918300-7918322 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1078074897 11:8149707-8149729 TTAGTTTTCAAGGTTACTTTGGG - Intronic
1078208221 11:9248690-9248712 TTAGTTTTTCAGGTTTCTCTAGG + Intronic
1078281029 11:9901427-9901449 TCAGTTTTTCAGGTTTCGCTGGG - Intronic
1078385873 11:10892121-10892143 CTAGTTTTTCAGGATAACTTTGG + Intergenic
1078517227 11:12033051-12033073 ATATTTGTTCAGATTTCTTTTGG - Intergenic
1078687053 11:13543018-13543040 ATAGTTTTAAAAGTTTCTTTTGG + Intergenic
1078820171 11:14871744-14871766 ATACTTTTTTGGGTTTCTTTAGG - Exonic
1078876331 11:15402461-15402483 ATTGGTTTTCAGATTTCTTTTGG + Intergenic
1079159116 11:17976129-17976151 CTAGCTCTTCAGGGTTCTTTTGG + Intronic
1079287764 11:19154637-19154659 CTACTAATTCAGGTTTATTTTGG - Intronic
1079296525 11:19240327-19240349 CTAGTTTGTCATTTTTCGTTAGG - Intronic
1079696692 11:23490658-23490680 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1079701019 11:23548060-23548082 CTACTTTTTCCAGTTTCTTGAGG + Intergenic
1079791443 11:24745011-24745033 ATGGTTTTGAAGGTTTCTTTTGG + Intronic
1079805527 11:24925308-24925330 CTAATTTTTCAGGTTAATTTAGG + Intronic
1080010470 11:27453855-27453877 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1080021506 11:27565200-27565222 TTAGATTTTCAGGTTTGTCTTGG - Intergenic
1080205904 11:29728580-29728602 CTAGTTTTTCTAGTTCCTCTAGG + Intergenic
1080881689 11:36327252-36327274 CTAGTTTTTCAGGTTTACCCTGG - Intronic
1080962587 11:37177900-37177922 GTAGTTTTTCAGGTTTCTCTGGG - Intergenic
1080988810 11:37505555-37505577 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1080992735 11:37559115-37559137 TTAGCTTCTGAGGTTTCTTTTGG - Intergenic
1081111120 11:39134838-39134860 CTTGTTTTTCTAGTTTCTTCAGG + Intergenic
1081149268 11:39606338-39606360 CCATTTTTTCATGTGTCTTTTGG - Intergenic
1081154048 11:39667195-39667217 CTAGCATTTCAGGTTTACTTTGG - Intergenic
1081274643 11:41133531-41133553 TCAGTTTTTAAGGTTTCTCTGGG - Intronic
1082111622 11:48282817-48282839 ATAGCTTTTGATGTTTCTTTTGG + Intergenic
1082147536 11:48688365-48688387 CCATTTTTTCATGTGTCTTTTGG - Intergenic
1082206832 11:49446642-49446664 CTAGTTTTAAAGGTTCCTTTTGG - Intergenic
1082267441 11:50134748-50134770 ATATTTTTTCAGGGTTCTGTGGG + Intergenic
1082288646 11:50343818-50343840 ATATTTTTTCAGGGTTCTGTGGG - Intergenic
1082643820 11:55697296-55697318 GCATTTTTTCATGTTTCTTTTGG + Intergenic
1082866403 11:57903655-57903677 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1083069396 11:59961281-59961303 ATAGTTCTTAAGGTTTCTCTGGG - Intergenic
1083083146 11:60114332-60114354 CTAGACTTTCAGGTTTATTTTGG + Intergenic
1083105194 11:60350844-60350866 CTAGTTTTTCAGGTTAATTTTGG - Intronic
1083239605 11:61377682-61377704 CTAGTCTTTCAGGTTTAGTTTGG + Intergenic
1083368646 11:62160145-62160167 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1083378149 11:62242924-62242946 CTGATTTTTCATATTTCTTTTGG - Intronic
1084025439 11:66445562-66445584 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1084365443 11:68694534-68694556 CTAATTTTTGAGGCTTCTTTGGG - Intergenic
1084586766 11:70066936-70066958 CTGCTTTTTCAAGTTTGTTTTGG - Intergenic
1084606715 11:70176723-70176745 CCAGTCTTTCAGGTTAATTTGGG + Intronic
1084744630 11:71161068-71161090 CTAGTTTTTCAGTTTTACTTTGG - Intronic
1085021143 11:73209196-73209218 CTAGTTTGTCATTTGTCTTTAGG - Intergenic
1085146495 11:74203380-74203402 CTAGTTTTTCACCTTGCTCTTGG - Intronic
1085166836 11:74409238-74409260 CTTATTTTTCAAGATTCTTTGGG + Intergenic
1085481434 11:76825771-76825793 CTAGTTTTTCAGGTTTTTGGGGG - Intergenic
1085489659 11:76903502-76903524 CCAGTTTTTCAGGTTTCTTTGGG - Intronic
1085619620 11:78028022-78028044 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1086096900 11:83059728-83059750 CTACTTTATCAGATTGCTTTTGG + Intronic
1086127683 11:83365974-83365996 CTTGTTCTTCAGATTTATTTTGG + Intergenic
1086542542 11:87930325-87930347 GTATTTTTTCATGTGTCTTTTGG + Intergenic
1086648438 11:89255115-89255137 CTGGTTTTGAAGGTTCCTTTTGG + Intronic
1087100943 11:94364125-94364147 CTTTTTTTTCAAGTGTCTTTTGG - Intergenic
1087226575 11:95607397-95607419 CTGATTTTTCAGGTTTCTTTGGG + Intergenic
1087256759 11:95964657-95964679 CTTGTTTGTCAGGTTTCTTTGGG + Intergenic
1087445686 11:98249804-98249826 CTAGTTTTGCAGGTATTCTTTGG + Intergenic
1087492959 11:98850985-98851007 CTTGTTTGACAGTTTTCTTTGGG - Intergenic
1088313752 11:108486852-108486874 CTAGTTTTTCAGATTAACTTTGG - Intronic
1088419116 11:109622699-109622721 GTATTTTTTCATGTGTCTTTTGG - Intergenic
1088458366 11:110056727-110056749 CTAGTTTTTTAGGTTAACTTTGG + Intergenic
1088508040 11:110545354-110545376 CTTGTTTTTCTGGTTCCTCTAGG - Intergenic
1088557951 11:111082049-111082071 TTTATTTTTCAGATTTCTTTAGG + Intergenic
1088561742 11:111122230-111122252 CTACTTTTTCAGGTTTCTTTGGG - Intergenic
1088800307 11:113299824-113299846 ATAGTTTTGAGGGTTTCTTTTGG - Intergenic
1089101943 11:115970300-115970322 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1089470263 11:118715089-118715111 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1089542574 11:119198778-119198800 CTAGTTCTTCAGGTTCACTTTGG - Intergenic
1089888162 11:121850333-121850355 TGAGTTTTTCTAGTTTCTTTAGG + Intergenic
1090230182 11:125096967-125096989 CAAGTTCTTTAGGTTTCCTTGGG - Exonic
1090290044 11:125535324-125535346 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1090483724 11:127092405-127092427 CTTGTTTTTCTAGTTTCTCTAGG - Intergenic
1090517385 11:127443626-127443648 CTAGTTTTGCAGTTTTTTCTGGG - Intergenic
1090559256 11:127912806-127912828 ATGGTTTTTAAGGTTTCTTTTGG + Intergenic
1091104244 11:132903481-132903503 GTAGTTTTTCAGGTTAACTTTGG - Intronic
1091417438 12:300907-300929 CTAGATTTTCTAGTTTATTTGGG - Intronic
1091757668 12:3065467-3065489 CTAGTTTTTCAAGTTTACTTTGG - Intergenic
1092682972 12:11008351-11008373 CCAGTTTTCCAGTTTTGTTTTGG - Intronic
1093008846 12:14082785-14082807 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1093100860 12:15027354-15027376 CTTGTTTTTCTGGTTCCTCTAGG + Intergenic
1093130327 12:15384141-15384163 CTAGATTTTAAGTTTTCTTTGGG + Intronic
1093589444 12:20883066-20883088 CTATATTTTCTGGATTCTTTTGG + Intronic
1093623762 12:21322781-21322803 CTTGCTTTTCAGGTTAATTTTGG + Intronic
1093710943 12:22329328-22329350 CTACTTTATAAGGTTGCTTTGGG + Intronic
1093777444 12:23092585-23092607 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1093812205 12:23504780-23504802 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1093870401 12:24284325-24284347 CAAGTTTCTCAGGCTTCTCTAGG + Intergenic
1093887204 12:24475814-24475836 CTAGTTTTTAAATTTTCTGTAGG - Intergenic
1094004394 12:25732605-25732627 CTAGAACTTCAGATTTCTTTTGG + Intergenic
1094009703 12:25794443-25794465 CAAGTTTTTCAGGTTAACTTTGG + Intergenic
1094114952 12:26901184-26901206 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1094133533 12:27100250-27100272 CTAGTTTTTCGGGTTAACTTTGG - Intergenic
1094183678 12:27618287-27618309 CTAGTTTTTCGGGTTAACTTTGG - Intronic
1094212367 12:27905946-27905968 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1094425009 12:30308205-30308227 CTGGTTTCTCAGGTTTCTTTGGG + Intergenic
1094597670 12:31880024-31880046 TTAGTTTTTCAGCTTGCTCTGGG + Intergenic
1094804375 12:34074381-34074403 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1095101857 12:38193295-38193317 CTAGCTTTTCAGGTTAACTTTGG + Intergenic
1095231194 12:39742111-39742133 TCAGTTTTTAAGGTTTCTCTGGG + Intronic
1095268090 12:40183522-40183544 CTAGATTTTCAGGTTTACTTTGG - Intergenic
1095332013 12:40977436-40977458 CTAGTTTTTCAGGTTACTTTTGG + Intronic
1095497621 12:42801852-42801874 CTAGTATTTCAGGTTAACTTAGG + Intergenic
1095786428 12:46113920-46113942 CACAATTTTCAGGTTTCTTTTGG - Intergenic
1095979163 12:47961123-47961145 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1095999601 12:48118185-48118207 CTAGTTTTTCAGATTAACTTTGG + Intronic
1096363168 12:51005891-51005913 CTAGTTTTTCAGGTTTTCTTTGG - Intronic
1096437734 12:51609036-51609058 ATGGTTTTGAAGGTTTCTTTTGG + Intronic
1097216826 12:57420659-57420681 CTAGTTTTCCATCTATCTTTAGG + Intronic
1097400121 12:59118371-59118393 CTAGTTTTTCAGGTTTTATCAGG - Intergenic
1097517677 12:60625296-60625318 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1097553192 12:61101540-61101562 CTTGTTTTTCAAGTTTCTTGAGG + Intergenic
1097584712 12:61501631-61501653 CTAGTGTTTCAGGTTAACTTTGG - Intergenic
1097600311 12:61683771-61683793 GTAGTTTTTGGGGTTCCTTTTGG - Intergenic
1097662184 12:62442853-62442875 CTTGCTTTTCTAGTTTCTTTAGG + Intergenic
1098039891 12:66343092-66343114 CTTCTTTTTCAAGTTTGTTTTGG + Exonic
1098114136 12:67156511-67156533 TCAGTTTTTAAGGTTTCTCTGGG + Intergenic
1098185431 12:67891416-67891438 CTAGATTATCATTTTTCTTTGGG + Intergenic
1098201968 12:68065571-68065593 ATTGTTTTTCTAGTTTCTTTAGG + Intergenic
1098291688 12:68962625-68962647 CTTGTTTTTCAGGTTAACTTTGG - Intronic
1098674721 12:73274388-73274410 CTAGTTTTTCAGGTTATCTTTGG + Intergenic
1098677773 12:73312888-73312910 TTTGTTTTTCTAGTTTCTTTAGG + Intergenic
1098876579 12:75872093-75872115 CTAGTTTTTCAGATTAACTTTGG - Intergenic
1099192159 12:79571728-79571750 ATTGTTTTTCTGGTTTATTTTGG - Intergenic
1099261214 12:80385257-80385279 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1099274802 12:80561213-80561235 CTAATTTTTCAGGTCTCTCCTGG - Intronic
1099308059 12:80982925-80982947 CTAGTTTTTCAGGTTAATTTTGG - Intronic
1099487564 12:83247436-83247458 CTTGTTTTTCTAGTTTCTCTAGG + Intergenic
1099544103 12:83955017-83955039 TTAGTTTTTCGGGTTTATTTTGG - Intergenic
1099733275 12:86533769-86533791 CTAGTTTCTCAGGTGTACTTTGG - Intronic
1099849742 12:88077278-88077300 CTAGTTTTTTAACTTTCCTTTGG + Exonic
1099875949 12:88405951-88405973 GCATTTTTTCAGGTGTCTTTTGG - Intergenic
1100299089 12:93290731-93290753 GTAGTTTTTCAGGCTTATTCTGG - Intergenic
1100663361 12:96724436-96724458 GCATTTTTTCAGGTGTCTTTTGG + Intronic
1100848499 12:98684770-98684792 CTAATTTTTGATGTTGCTTTTGG + Intronic
1101405226 12:104422719-104422741 CTAGCTTTTCAGGTTAACTTTGG + Intergenic
1101505786 12:105345013-105345035 CTAGTTTTGCAGGTTAACTTAGG - Intronic
1101537035 12:105627875-105627897 CTATATTTTCAGGTTTACTTTGG + Intergenic
1101609421 12:106277040-106277062 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
1101678304 12:106939925-106939947 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1101679184 12:106948184-106948206 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1101684787 12:107008267-107008289 CTAGATTTTCATTTTTCTTTTGG - Intronic
1101713031 12:107286438-107286460 CTAGTTTTCCAGGTTAACTTTGG - Intergenic
1101855509 12:108439595-108439617 TCAGTTTTTCAGTTTTCTCTGGG - Intergenic
1101920960 12:108932625-108932647 TCAGTTTTTCAGGTTTCTCTGGG - Intronic
1102416043 12:112763787-112763809 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1102444424 12:112990892-112990914 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1102838549 12:116092050-116092072 ATAGTTTTACAGCTTTTTTTTGG - Intronic
1104263499 12:127207727-127207749 CTTATTTTTCTGGTTTCTTTTGG + Intergenic
1104504260 12:129316448-129316470 CTGGTTTAGTAGGTTTCTTTTGG + Intronic
1104680851 12:130750564-130750586 CTAGTTTTTCAGGTTCAATTTGG + Intergenic
1104781806 12:131426430-131426452 CTAGGTTTTCAGGTTAACTTTGG - Intergenic
1105335463 13:19463548-19463570 CTTGCTTTTCATGTTTCTTGTGG + Intronic
1105436967 13:20388084-20388106 CTACTTTTTCTGTTTTGTTTTGG - Intergenic
1105769961 13:23599854-23599876 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1105890279 13:24677647-24677669 CTAATTTTTGTGGTTTTTTTTGG - Intergenic
1106286652 13:28323839-28323861 CCAATTTCTCAGGTTTCTTTGGG + Intronic
1106431317 13:29683214-29683236 GTGGTTTTTCAGGGTTCTGTGGG - Intergenic
1106434509 13:29712018-29712040 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1106902369 13:34367540-34367562 GTATTTTTTCAGATGTCTTTTGG - Intergenic
1106979658 13:35263011-35263033 CTTCTTTTTCAGGATTATTTTGG - Intronic
1107072894 13:36291051-36291073 CTAGTTTGTCAGGTTTCTTTGGG - Intronic
1107082469 13:36389465-36389487 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1107155806 13:37165955-37165977 CTAGATTTTCAGATTTACTTTGG - Intergenic
1107310909 13:39076516-39076538 GTTGTTTTTCTGGTTTGTTTAGG - Intergenic
1107911275 13:45107850-45107872 CTAGATTTTCAGGTTTACTTTGG + Intergenic
1108200183 13:48035456-48035478 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
1108298878 13:49054141-49054163 CTAGTTTTTCAGGTTCAGTTGGG + Intronic
1108315989 13:49238097-49238119 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1108448539 13:50535336-50535358 GTATTTTTTGAGGTTTTTTTTGG + Intronic
1108613661 13:52109217-52109239 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1108626917 13:52238640-52238662 CTTGTTTTTCTGATTTCTCTCGG - Intergenic
1108659150 13:52567819-52567841 CTTGTTTTTCTGATTTCTCTCGG + Intergenic
1108696310 13:52905510-52905532 GTAGTCTTTCAGTTTTATTTTGG + Intergenic
1108883245 13:55147428-55147450 TTAGGTTTTCAGGTTTCTCAGGG - Intergenic
1108920101 13:55662306-55662328 TCAGTTTTTCAGGTTTCTTTGGG + Intergenic
1108939994 13:55940943-55940965 CTAGACTTTCAGGTTTGCTTTGG - Intergenic
1108962316 13:56249040-56249062 CTTGTTTTTCTAGTTTCTTGAGG + Intergenic
1109001929 13:56815644-56815666 ATAGTTTTTAGGGTTCCTTTTGG - Intergenic
1109216530 13:59596004-59596026 GTATTTTTTCATGTGTCTTTTGG - Intergenic
1109581303 13:64340002-64340024 CTAGTTATTCAGGTTAACTTTGG + Intergenic
1109592438 13:64503561-64503583 GTATTTTTTCATGTGTCTTTTGG + Intergenic
1109806935 13:67455684-67455706 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1109869722 13:68318414-68318436 CTTGTTTTTCTAGTTCCTTTAGG + Intergenic
1109978676 13:69875813-69875835 ATTGTTTTTAAGATTTCTTTTGG + Intronic
1110048951 13:70870111-70870133 CCAGTTTTTCAGGTCTGGTTCGG + Intergenic
1110221253 13:73076470-73076492 CAAGTTTTTTAGGATTCTTTTGG + Exonic
1110459369 13:75728384-75728406 GTATTTTTTCATGTGTCTTTTGG + Intronic
1110718306 13:78732779-78732801 CTAGCTTTTCAGGTTTACTTTGG - Intergenic
1110869636 13:80435249-80435271 CTAGTCTTTCAGGTTAACTTTGG - Intergenic
1110928376 13:81184592-81184614 CTAGATTTTCAGGTTAACTTTGG - Intergenic
1110982419 13:81917989-81918011 CTAGTTTTTCAGGTTTGCTTTGG - Intergenic
1111022871 13:82477822-82477844 TTAGTTTTCAAGGTTTCTCTGGG + Intergenic
1111034784 13:82657932-82657954 CTAGTTTTTCAGGTATCTTTGGG + Intergenic
1111045472 13:82808430-82808452 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1111160373 13:84386622-84386644 CTTGTTTTTCTAGTTTCTTAAGG - Intergenic
1111172196 13:84541962-84541984 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1111278905 13:85991843-85991865 GTAGTTTTGCAGGAATCTTTAGG + Intergenic
1111288005 13:86120421-86120443 CTAGTTTTTCAGATTTACTTTGG + Intergenic
1111328814 13:86735141-86735163 CTAGGTTTTCAAGTTTGTTAGGG - Intergenic
1111559646 13:89928739-89928761 CCAGCTTTTCAGGTTTCTCTGGG - Intergenic
1111646298 13:91036055-91036077 TTAGTTTTTCAGTATCCTTTGGG - Intergenic
1111686623 13:91509576-91509598 CTTGTTTTTCATGTTACATTAGG + Intronic
1111748119 13:92295320-92295342 ATGGTTTTGAAGGTTTCTTTTGG + Intronic
1111787597 13:92809882-92809904 CTAGGTTTACAAGTTTCTCTAGG - Intronic
1111846676 13:93518083-93518105 ACAGTTTTTCAGTTTTGTTTGGG + Intronic
1111895941 13:94141572-94141594 TTCGTTTTTCAGGTTTCTCTGGG + Intronic
1112079553 13:95954324-95954346 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1112185964 13:97127978-97128000 CTAGATTTTCAGGTTTCTGTAGG + Intergenic
1112261337 13:97880824-97880846 CTGGTTTTCCAGGTTAATTTTGG - Intergenic
1112515766 13:100051622-100051644 TCAGTTTTTCAGCTTTCTCTGGG + Intergenic
1112553484 13:100444823-100444845 GCTGTTTTTCAGTTTTCTTTTGG + Intronic
1112647917 13:101356424-101356446 CTAGATTTTCTAGTTTATTTAGG - Intronic
1112747570 13:102544137-102544159 CTTGTTTTTCTAGTTTCTTGAGG - Intergenic
1112868717 13:103941899-103941921 CCAGTTTTTCAGGTTACCTTTGG - Intergenic
1112886677 13:104182090-104182112 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1113158459 13:107352299-107352321 TAAGTTTTTCAGGTTTCTCTGGG + Intronic
1113229544 13:108196683-108196705 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1113248871 13:108429099-108429121 CTAGCTTTTCCAGTTTCTTTTGG - Intergenic
1113449613 13:110398178-110398200 CTATTTTTACATGTTCCTTTAGG + Intronic
1113509006 13:110837145-110837167 TCAGTTTTTGAGGTTTCTCTGGG + Intergenic
1113586063 13:111466535-111466557 TTAGCTGTTCAGGCTTCTTTTGG + Intergenic
1113710419 13:112460680-112460702 CTATTTTTTCAAGTTTCTTAAGG + Intergenic
1113918664 13:113890867-113890889 TTAGTTTTTCAGGTTTCTCTGGG - Intergenic
1113971861 13:114197452-114197474 CTAGTTTGTCAGGTTAACTTAGG + Intergenic
1114224166 14:20723354-20723376 CTACTTTTTCAGTTTCCTTGTGG - Intergenic
1114346321 14:21798995-21799017 CTATTTTTTCAGGTTAACTTCGG + Intergenic
1114441627 14:22752861-22752883 CTAGTTTTTCAGGTTAATTCTGG + Intergenic
1114707508 14:24742250-24742272 CTAGTTTTTTAGGTTAACTTTGG - Intergenic
1114853736 14:26412664-26412686 CTAGTGTTTCAGGTTGACTTTGG + Intergenic
1114892012 14:26936768-26936790 CTAGTTTTTCAGGTTGCTTTGGG + Intergenic
1115303471 14:31910962-31910984 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1115320394 14:32074788-32074810 ATAATTTTTAAGGTATCTTTAGG + Intergenic
1115476379 14:33817759-33817781 CTGGTTTTTCTGGTTTCTACTGG - Intergenic
1115478375 14:33837923-33837945 CTATTTTTTCAGTTTTATTGAGG - Intergenic
1115532714 14:34341978-34342000 CTAGTTTTTCAGGTAAACTTTGG + Intronic
1115532733 14:34342106-34342128 TCAGTTTTTCAGGTTTCTTTGGG - Intronic
1115826841 14:37288147-37288169 TAAGTTTTTGAGGTTTTTTTTGG + Intronic
1115883787 14:37948879-37948901 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1115900996 14:38148107-38148129 CTAGATTTTCAGGTTTACTTTGG - Intergenic
1115904323 14:38189974-38189996 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1115933544 14:38526116-38526138 CTAGTTTTTCAGGTTAACTATGG + Intergenic
1115938591 14:38583369-38583391 TCAGTTTTTTAGGTTTCTTTGGG - Intergenic
1116054739 14:39849232-39849254 CTAGTTTTTCAGGTTAACTCTGG - Intergenic
1116239333 14:42321093-42321115 TTAGTTTTTAAGGTTTTTTGGGG + Intergenic
1116335739 14:43653972-43653994 ATGGTTTTGGAGGTTTCTTTTGG - Intergenic
1116472532 14:45302677-45302699 CTTGTTTTTCTGGTTCCTTTAGG + Intergenic
1116848178 14:49883812-49883834 TCAGTTTTTAAGGTTTCTTTGGG + Intergenic
1116885986 14:50222269-50222291 CAAGTTTTTCAAAATTCTTTTGG + Intronic
1116978561 14:51142858-51142880 CTAGTTTTTCAGGTTTCCTTGGG + Intergenic
1116985013 14:51209430-51209452 TTTGTATTTCAGGTTTCTGTTGG + Intergenic
1117769372 14:59117663-59117685 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
1117891845 14:60430600-60430622 TTAGTTTTTCAGGTTAATTTTGG + Intronic
1117969805 14:61240574-61240596 CTGGTTTTTCAAGCCTCTTTCGG + Intronic
1118068694 14:62221314-62221336 CTTGTTTTTCTAGTTTCTTTAGG + Intergenic
1118083690 14:62391173-62391195 CAAGTATTTCAGGATTTTTTAGG + Intergenic
1118105742 14:62657471-62657493 CTAGTTTTTCAGATATATTTAGG - Intergenic
1118158611 14:63266386-63266408 CTAGTTTTTCAGGTTTACTTTGG + Intronic
1118491576 14:66266020-66266042 CTAGTTTTTCAGATTTACTCTGG + Intergenic
1118565525 14:67136642-67136664 CTAGTTTTTCAGGATCATCTAGG + Intronic
1118652074 14:67907292-67907314 CTTGTTTTTTTGGTTTCTCTAGG + Intronic
1118831089 14:69433701-69433723 GTACTTTTTAAAGTTTCTTTAGG + Intronic
1118977709 14:70691895-70691917 TCAGTTTTTAAGGTTTCTCTAGG + Intergenic
1119089618 14:71769415-71769437 CTTCTTTTTCAAGATTCTTTGGG - Intergenic
1119094547 14:71816792-71816814 CTAATTTGTGAAGTTTCTTTGGG - Intergenic
1119451992 14:74719597-74719619 CTAATTTTTGTGGTTTCTTTTGG - Intronic
1119958268 14:78824249-78824271 TTAGTTTTTAAGGTTTCTCTGGG + Intronic
1120008529 14:79387333-79387355 GCATTTTTTCATGTTTCTTTTGG - Intronic
1120262911 14:82210731-82210753 CTAGTTTTTCTAGTTTCTGAAGG + Intergenic
1120267716 14:82272636-82272658 CTAGTTTTTCAGATTAACTTTGG + Intergenic
1120268009 14:82275804-82275826 CTAGTTTTTCAAGTTAACTTTGG + Intergenic
1120295986 14:82641679-82641701 CCATTTTTTCAGCTTTCATTTGG - Intergenic
1120406894 14:84102034-84102056 CTAGTTTTTCAGGTTAACTTAGG - Intergenic
1120607391 14:86595987-86596009 CTAGTTTTTTATTTTTCTGTTGG - Intergenic
1120618996 14:86739677-86739699 CTACTTGTTCAGGTTTCTTTGGG + Intergenic
1120732165 14:88015984-88016006 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
1120769678 14:88365345-88365367 CTGGTTTTTCAGATTCCTTTGGG + Intergenic
1120806503 14:88757006-88757028 CTTGTTTTTCAGGATAGTTTTGG - Intronic
1120942450 14:89961661-89961683 TCAGTTTTTAAGGTTTCTCTGGG + Intronic
1121167704 14:91823129-91823151 TTATTTTTTCAGGTTTATTGAGG - Intronic
1121425020 14:93844398-93844420 CTAGTTTTTCAGGCTTATTTTGG + Intergenic
1121707095 14:96005316-96005338 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1121960657 14:98256386-98256408 TTAGTTTTTAAGGTTCCTTTGGG - Intergenic
1122640928 14:103158830-103158852 CCAGTTTTTCAGGTTAGCTTTGG - Intergenic
1122914286 14:104850118-104850140 CTAGTTTTTAGAGTTGCTTTTGG + Intergenic
1123850803 15:24354584-24354606 TTAGTTTTTCAGGTTGCTTTGGG + Intergenic
1124075725 15:26442793-26442815 CTACTTTTTCAGGTTAACTTTGG + Intergenic
1124201781 15:27684739-27684761 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1124510321 15:30318854-30318876 CTCAGTTTTCAGGTTTCTGTGGG + Intergenic
1124603407 15:31152524-31152546 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1124732568 15:32211699-32211721 CTCAGTTTTCAGGTTTCTCTGGG - Intergenic
1124958340 15:34374991-34375013 CTAGTTTTTCAGGTTAATTTTGG - Intergenic
1125129365 15:36263767-36263789 CTTGTATTTCCGATTTCTTTGGG - Intergenic
1125134699 15:36328319-36328341 CTAGTGTTACAGGATTTTTTTGG + Intergenic
1125318229 15:38454821-38454843 ATAGTTTTTCAGATTACTCTTGG + Intronic
1125341325 15:38678430-38678452 CTAGTTTTTCAGGTTTACTTGGG - Intergenic
1125878478 15:43170299-43170321 TCAATTTTTAAGGTTTCTTTGGG + Intronic
1125998218 15:44184354-44184376 CAAGGTTTTCAGGAATCTTTAGG + Intronic
1126041853 15:44598999-44599021 GTAGCTTTTCAGTTGTCTTTTGG + Intronic
1126158308 15:45585686-45585708 CTAGATTTTCAGGTTTACTTTGG + Intergenic
1126946027 15:53821516-53821538 CTAGTTTTCCAGGTTAACTTTGG - Intergenic
1127194014 15:56564781-56564803 CTAGATTTTCTGGTTTATTTGGG - Intergenic
1127575307 15:60286088-60286110 CTAATTTTTCAGGTTAACTTTGG + Intergenic
1127930148 15:63590381-63590403 CTAGTTTTCCATGTTTCCGTAGG + Intronic
1127950112 15:63796997-63797019 CTAGTTTATCAGGTTAACTTTGG + Intronic
1127972809 15:63975016-63975038 AAAGTTTTTCAGGTTTACTTTGG + Intronic
1128529679 15:68435906-68435928 CCACTTTTTCTGGTTCCTTTAGG - Intergenic
1128603475 15:69016913-69016935 CTAGTTTTTCAGGCTAACTTTGG - Intronic
1128694791 15:69753078-69753100 TTATTTTTTAAGGTTTTTTTTGG - Intergenic
1128775217 15:70315254-70315276 TTAGTTTTTCAAGTTTCTTTGGG + Intergenic
1129020969 15:72517854-72517876 CTACTATGTCAGGTTTCTTTAGG - Intronic
1129532889 15:76283122-76283144 CTGGTTTTTCATCTTTTTTTTGG - Intronic
1129927096 15:79374396-79374418 CTAATTTTTTAGGTTTACTTTGG + Intronic
1129975635 15:79819083-79819105 CCAATTGTCCAGGTTTCTTTTGG - Intergenic
1130157900 15:81369152-81369174 CTAGTTTGACAGGTTTGATTGGG + Intronic
1130291877 15:82609555-82609577 TTATTTTTTCTAGTTTCTTTAGG - Intronic
1130319202 15:82826009-82826031 CTAATTTTTCAGGTATTTGTAGG + Intronic
1130619758 15:85450181-85450203 CTAGTTTTTCTAGTTTGTGTGGG + Intronic
1130802883 15:87284749-87284771 CTTGTTTTTAAGGATTATTTTGG - Intergenic
1130873679 15:87993508-87993530 ATAGTTCTTCACCTTTCTTTGGG + Intronic
1130889780 15:88123989-88124011 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1131001038 15:88940527-88940549 CTAGTTTTTCACTTTCATTTTGG + Intergenic
1131464961 15:92647486-92647508 TTAGTTTTTCAGGTTTCTCTGGG - Intronic
1131765962 15:95676340-95676362 CTAGTTTCTCATATTTCTTTAGG + Intergenic
1132254975 15:100368511-100368533 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1132263599 15:100446785-100446807 CTAGATTTTCAGGTTTACATTGG - Intronic
1132423776 15:101696673-101696695 TCAGTTTTTAAGGTTTCTCTGGG - Intronic
1133000057 16:2845758-2845780 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1134171493 16:11973266-11973288 CTAGTTTTTCAGGTTGCCTTTGG + Intronic
1134338686 16:13325439-13325461 CTAGTTTTTCAGGTTTCTTTAGG + Intergenic
1134800649 16:17081512-17081534 CTAGTTTTTCAAGTTAACTTTGG + Intergenic
1135059689 16:19260625-19260647 CTAGCTTTTCAGGTCACCTTTGG + Intronic
1135236359 16:20759950-20759972 CTAATTTTTCAGATTTCCTTGGG - Intronic
1135323222 16:21510511-21510533 CTCGTTTTTCAGGTTAACTTTGG - Intergenic
1135679514 16:24444498-24444520 TGAGTTTTTAAGGTTTCTTTGGG - Intergenic
1135807874 16:25559530-25559552 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1135838895 16:25855692-25855714 TTAGTTTTTCAGGTTACTCTGGG + Intronic
1135912554 16:26574672-26574694 CTAGTCTTTCAGGTTAGCTTTGG - Intergenic
1135982260 16:27157048-27157070 CTAGTTTTTTGGGTTAGTTTTGG - Intergenic
1136289597 16:29263519-29263541 CTTGTTTTTTAGGTTTACTTTGG + Intergenic
1136334705 16:29603698-29603720 CTCGTTTTTCAGGTTAACTTTGG - Intergenic
1136729699 16:32398342-32398364 CTTGTTTTTCTGTTTCCTTTAGG + Intergenic
1137372319 16:47919032-47919054 TTAGTTTTTCACGTTTCTCTGGG + Intergenic
1137383235 16:48018229-48018251 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1137461175 16:48665095-48665117 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1138004122 16:53314811-53314833 GTTTTTTTACAGGTTTCTTTAGG + Exonic
1138226374 16:55298947-55298969 CTAGATTTTGAGGATTCCTTTGG + Intergenic
1138262544 16:55635596-55635618 CTAGTTTTTCAGATTTACTTGGG + Intergenic
1138632306 16:58307650-58307672 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1138633278 16:58316439-58316461 CTAGTTTTTCAGATTAACTTTGG - Intronic
1138843350 16:60536060-60536082 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1139102564 16:63786287-63786309 TTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1139302612 16:65958422-65958444 CTAGTTTTTTAAGTTTTCTTTGG + Intergenic
1140334353 16:74090576-74090598 CTAGTTTTGTATTTTTCTTTGGG + Intergenic
1140458286 16:75117017-75117039 TTAATTTTTCAGGTTTATTTTGG - Intergenic
1140518093 16:75559008-75559030 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1140520481 16:75576736-75576758 CTATTTTTGGAGGGTTCTTTGGG + Intronic
1140782372 16:78308318-78308340 CTAGTTTTTCAGGTTTATTTCGG - Intronic
1141241187 16:82266675-82266697 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
1141411906 16:83840848-83840870 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1141914749 16:87087595-87087617 TTAGTTTTTCAGGTTGCTATGGG - Intronic
1142035420 16:87859533-87859555 CTCGTTTTTCAGGTTAACTTTGG - Intronic
1142095331 16:88236499-88236521 CTTGTTTTTCAGGTTTACTTTGG + Intergenic
1202996697 16_KI270728v1_random:118962-118984 CTTGTTTTTCTGTTTCCTTTAGG - Intergenic
1203023384 16_KI270728v1_random:431304-431326 CTTGTTTTTCTGTTTCCTTTAGG - Intergenic
1144096857 17:11907552-11907574 CTAGTTTTTCAAGTTAACTTTGG + Intronic
1144144041 17:12380185-12380207 CTAGTTTTTTGGGTTTAGTTGGG - Intergenic
1144228456 17:13174832-13174854 CCATTTTTTCATGTGTCTTTTGG - Intergenic
1144483038 17:15643179-15643201 CTGGTTTTTCAGGTTAACTTTGG - Intronic
1144570757 17:16397104-16397126 CTAGATTTTCAGATTTACTTGGG - Intergenic
1144711236 17:17403008-17403030 CTAATTTTTCAAATTTTTTTTGG - Intergenic
1144915643 17:18721851-18721873 CTGGTTTTTCAGGTTAACTTTGG + Intronic
1145027892 17:19482706-19482728 CTAGTTTCTCAAGTTTAGTTTGG - Intergenic
1145095994 17:20027098-20027120 CTTGTTTTTCAAGTTTGTTTTGG - Intronic
1145096117 17:20028663-20028685 CGTGTTTTTCAAGTTTGTTTTGG + Intronic
1145223653 17:21109555-21109577 TCAGTTTTTCAGGTTTCTCTAGG - Intergenic
1145284974 17:21498644-21498666 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
1145362892 17:22226878-22226900 CTAGATTTTCAGATTTCCTTGGG - Intergenic
1145405497 17:22586981-22587003 CTAGCTTTTCAGGTTAACTTTGG - Intergenic
1146099399 17:29964858-29964880 CTACTTTTTCGAGTTTCTTAAGG + Intronic
1146513081 17:33467444-33467466 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1146592072 17:34136008-34136030 CTAGTTTTTCAGGTTTCTCCAGG - Intronic
1147462950 17:40586701-40586723 ATAGTTTTGAAGGTTCCTTTTGG + Intergenic
1148388206 17:47251789-47251811 CTAGTTTTTCAGATTAACTTTGG + Intergenic
1148951849 17:51320234-51320256 CTAGTTTTTCAGGTTTATTTTGG + Intergenic
1149016957 17:51919036-51919058 CCAGTTTTTCAGTTTTAATTTGG + Intronic
1149021044 17:51964834-51964856 CTTGTTTTTCAGGTTTCTCTAGG - Intronic
1149120380 17:53156317-53156339 TCAGTTTTTAAGGTTTCTCTGGG + Intergenic
1149215346 17:54347470-54347492 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1149957861 17:61073118-61073140 CTATTATTTCAGCATTCTTTTGG - Intronic
1150049463 17:61946590-61946612 TTTGCTTTTCAGGTTTGTTTTGG - Exonic
1150518660 17:65842884-65842906 TTATTTTTTAAGGTTTTTTTTGG + Intronic
1150952970 17:69822819-69822841 CTAGTGTTACAGGATTCTTGGGG - Intergenic
1152823890 17:82451627-82451649 CTAGTTTTTCAGGATAACTTGGG - Intergenic
1152871436 17:82755658-82755680 CTAGTTTTTCAGGTTAAGTTTGG + Intronic
1153015585 18:580060-580082 CCAGTTTTATAGGTTTCTTTAGG - Intergenic
1153121993 18:1739792-1739814 TTAGTTTTTCAGATTTAGTTTGG + Intergenic
1153572589 18:6488053-6488075 CTAGTTTTTCAGGTTAACTTGGG - Intergenic
1153867980 18:9290817-9290839 CTAGTTTTTCAGGTTATCTTTGG - Intergenic
1153987210 18:10363070-10363092 CTAGGTTTTCAGATTTATTGGGG - Intergenic
1154048416 18:10929880-10929902 CTGGTTTTTTAGGCTTCTTTGGG - Intronic
1154113541 18:11591118-11591140 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
1154401655 18:14043799-14043821 CTAGTTTTTCTGGTATTTTCTGG + Intergenic
1154460565 18:14580732-14580754 GTAGTTTTTTTGTTTTCTTTTGG + Intergenic
1155128780 18:22908511-22908533 CTTCTTTTTCTGGTTTCTTAAGG + Intronic
1155404675 18:25474782-25474804 TCATTTTTTCAGGTTCCTTTAGG + Intergenic
1155599770 18:27532142-27532164 GCAGTTTTTCATGTGTCTTTTGG - Intergenic
1155736300 18:29226652-29226674 CTAGTTTTTCAGGTTAACTTAGG - Intergenic
1155850486 18:30768442-30768464 TTAGTTTTTCAGGTTAACTTTGG - Intergenic
1156082614 18:33356558-33356580 CTAGCTTTTTAGGTTTCTTTGGG - Intronic
1156095762 18:33530172-33530194 ATAGTTTTGAAGGTTCCTTTTGG + Intergenic
1156116554 18:33793225-33793247 ATATTTTTTCATGTGTCTTTTGG - Intergenic
1156378774 18:36538259-36538281 CTCCTTTTTCAAGTTTCTTGTGG - Intronic
1156420558 18:36948037-36948059 CTTGTTTTTCAGGTTTACTTTGG + Intronic
1156573182 18:38281907-38281929 GAATTTTTTCAGGTTTCTCTTGG - Intergenic
1156581086 18:38376065-38376087 CTATTTTTTCAAGTTTCTTATGG - Intergenic
1156740793 18:40325163-40325185 GTATTTTTTCATGTGTCTTTTGG + Intergenic
1156816715 18:41320302-41320324 CCAGTTTTTCAGGTTTACTCTGG + Intergenic
1156919971 18:42509857-42509879 CCTGATTTTCAGTTTTCTTTTGG + Intergenic
1156926989 18:42594232-42594254 CTTGTTTTTCTAGTTTCTCTAGG + Intergenic
1157077785 18:44485340-44485362 CTTGTTTTTCTAGTTTCTTGAGG - Intergenic
1157163351 18:45335705-45335727 GAAGTTTTTCAGGTTTCTTAGGG - Intronic
1157163594 18:45337541-45337563 TCAGTTTTTCAGGTTTCTCTGGG - Intronic
1157671032 18:49528898-49528920 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1157721088 18:49925032-49925054 CTAGTGTTTCAGGTTAACTTTGG - Intronic
1158164945 18:54529709-54529731 GTAGTTTTTCAGGGTTCTTTGGG + Intergenic
1158166758 18:54548862-54548884 CTAGTTTTTCAGATTAACTTTGG + Intergenic
1158279745 18:55811069-55811091 CCAGTTTGTCATTTTTCTTTTGG + Intergenic
1158375553 18:56859307-56859329 CTAATTTTTATTGTTTCTTTAGG + Intronic
1158569291 18:58583363-58583385 CTAGTTTTTTAGGTTTCTTAGGG + Intronic
1158617499 18:59001650-59001672 CTAGTTTTTCAGGTTGACTTTGG + Intergenic
1158756750 18:60334267-60334289 ATGGTTTTGAAGGTTTCTTTTGG - Intergenic
1158797697 18:60867599-60867621 CTAGTTTTTCTGGATACTTATGG - Intergenic
1158929582 18:62310485-62310507 TTAGTTTTGAAGGTTTCTCTGGG - Intergenic
1159111702 18:64066840-64066862 CTTGCTTTTCTAGTTTCTTTAGG + Intergenic
1159208009 18:65279181-65279203 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1159218216 18:65425042-65425064 CTAATGTTTCAGTTTTGTTTTGG + Intergenic
1159229410 18:65586663-65586685 ACAGTTTTTTAGGTTTTTTTAGG + Intergenic
1159323547 18:66886900-66886922 CTAGTTTTTCAGGTTAATTTTGG + Intergenic
1159715435 18:71816155-71816177 CTAGTTCGTCTGGTTTCTTTGGG + Intergenic
1159723513 18:71923549-71923571 CTTGTTTTTCTGTTTTCTCTAGG - Intergenic
1159899730 18:74034824-74034846 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1159992711 18:74928798-74928820 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1161161557 19:2764561-2764583 CTAATTTTTGTGGTTTTTTTCGG + Intronic
1162204349 19:9044581-9044603 CTAGTTTTTCAGGTTCCTTTGGG - Intergenic
1162597102 19:11638113-11638135 CTAGATTTTCAGGTTTACTTTGG + Intergenic
1162694669 19:12464446-12464468 TTAGTTTTTCTAGTTCCTTTCGG - Exonic
1162707909 19:12569365-12569387 CTTGTTTTTCAAGATTGTTTTGG + Intronic
1163088162 19:14998132-14998154 CTAGTTTTTCAGGTTAATTTTGG - Intronic
1163223600 19:15939346-15939368 TCAGTTTTTAAGATTTCTTTTGG - Intergenic
1163746146 19:19048988-19049010 GTAGTTTTTCAGGTTACCTTTGG + Intronic
1164265889 19:23616877-23616899 CTAGATTTTCTAGTTTATTTGGG - Intronic
1164431260 19:28190851-28190873 CTAGTTTTTTGGGTTTCTTTGGG - Intergenic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
1164484827 19:28646136-28646158 CTAGAAGTACAGGTTTCTTTTGG + Intergenic
1164518419 19:28956695-28956717 CCAGTTTTTAAGGTTTATCTGGG + Intergenic
1164613624 19:29650964-29650986 CCCGTTTTTCAGGTTAATTTTGG + Intergenic
1164688183 19:30185418-30185440 ATATTTTTTCATGTGTCTTTTGG + Intergenic
1165133716 19:33650242-33650264 CCAGTTTTTAAGATTTCTCTGGG + Intronic
1165249785 19:34520647-34520669 CTAGTTTTTTAGGTTAGCTTTGG + Intergenic
1165265081 19:34655162-34655184 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1165692619 19:37875402-37875424 TCAGGTTTTCAGGTTTCTCTGGG - Intergenic
1165916251 19:39262676-39262698 CTGGTTTTTCAGGTTAACTTTGG - Intergenic
1166490671 19:43258010-43258032 CTTGTTTTTCTGTTTTCTTATGG - Intronic
1166512608 19:43419695-43419717 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
1166913490 19:46177867-46177889 TTAGTTTTTCAGATTTCTCTTGG - Intergenic
1167406737 19:49314615-49314637 CTAGTTTCTTGGGTTTTTTTGGG - Intronic
1167766696 19:51488043-51488065 CTACTTTTTCTGGTTTTGTTTGG - Intronic
1168421858 19:56209389-56209411 CTATTGTTTTAGGTTTATTTTGG + Exonic
1168584231 19:57579631-57579653 CTAGTTTTTCAGATTAACTTTGG + Intronic
924979181 2:205122-205144 CTAGTTTTCCAGGTTAACTTTGG - Intergenic
925124888 2:1447085-1447107 TTAGTTTTTCAGGTTAGCTTTGG - Intronic
925485048 2:4319292-4319314 CTAGGTTTGTAAGTTTCTTTAGG + Intergenic
925981144 2:9178557-9178579 CTGGTTTTTCAGGTTGACTTTGG + Intergenic
926296861 2:11575251-11575273 CTGGTATGTCTGGTTTCTTTGGG - Intronic
926382452 2:12303953-12303975 CTAATTTTTCAGGTTTAGTTGGG - Intergenic
926517098 2:13861037-13861059 GTGGTTTTTCAGGTATCTTGAGG - Intergenic
926919297 2:17925154-17925176 CTCATTTTTCAGGTTAATTTGGG - Intronic
927113230 2:19878939-19878961 CTAGCATGTCAGTTTTCTTTGGG - Intergenic
927401163 2:22712260-22712282 TTAGTTTTTCTAGTTACTTTAGG + Intergenic
927490128 2:23515788-23515810 CTAGTCCTTGTGGTTTCTTTGGG - Intronic
927950381 2:27164259-27164281 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
927950498 2:27165115-27165137 CTAGTGTTTCAGGTTAACTTTGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928102356 2:28446563-28446585 CTAATTTTTCAATTTTTTTTAGG - Intergenic
928258281 2:29743792-29743814 CCAGGTTTGCAGGCTTCTTTAGG + Intronic
928519283 2:32072543-32072565 CTAGTTTTTTAGGTTAACTTTGG + Intronic
928604726 2:32935220-32935242 CTAGTTTTTCAGATTAACTTTGG - Intergenic
928806304 2:35160781-35160803 ATAGTTTTTCCGGTATCTTTGGG + Intergenic
928975403 2:37081898-37081920 TTAGTATTTTAGGTTTCTGTAGG - Intronic
929211762 2:39365331-39365353 CTAGTTTTTCAGGTTAACTTTGG + Intronic
929324961 2:40598670-40598692 CATGTTTTTCTGGTTTCTTACGG - Intronic
929481448 2:42312297-42312319 CCAGTTTTTCAGGTTAATTTTGG - Intronic
930213970 2:48673678-48673700 ATAGTTTTCCCTGTTTCTTTGGG - Intronic
930285447 2:49422334-49422356 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
930403002 2:50914806-50914828 CAAGTTTGTCAAGTTTCCTTTGG - Intronic
930488329 2:52036953-52036975 CTAGGTTTTCAGGTTAACTTTGG - Intergenic
930562152 2:52973352-52973374 TCAGTTTTTAAGGTTTCTCTGGG + Intergenic
930569708 2:53070090-53070112 TTATTTTTTCATGTGTCTTTTGG - Intergenic
930777775 2:55191765-55191787 CTACTTTTTCTGGCTTCTTTTGG - Intronic
931042192 2:58313165-58313187 CTAGATTTTCAGGTTTACTTTGG + Intergenic
931341001 2:61400683-61400705 CTAGTTTTTCAATTTTTTTGAGG - Intronic
931414878 2:62071750-62071772 TTAGTTTTTCAGGTGGCTCTGGG - Intronic
931422949 2:62144695-62144717 GAACTTTTTCAGGTTTTTTTTGG - Intronic
931446444 2:62331160-62331182 CTAGTTTTTCAGGTTAGCTTTGG + Intergenic
931555869 2:63504148-63504170 AAAGGTTTTCAGGTCTCTTTTGG - Intronic
931862397 2:66369742-66369764 CTAGTGTTGCAGCTTTATTTTGG - Intergenic
932069619 2:68606323-68606345 CTAGTCTTTTGGGTTTCTCTAGG + Intronic
932100300 2:68893326-68893348 CTAGTTTCTCTAGTTTCTTGAGG + Intergenic
932267741 2:70382857-70382879 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
932959709 2:76398279-76398301 CTTGTTTTTCAGGTTTACTTTGG - Intergenic
933059099 2:77713410-77713432 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
933080023 2:77974503-77974525 CTATATTTCCAGGTTTCTTTGGG - Intergenic
933228616 2:79779860-79779882 CTAGTTTTTCAGGTTAACTTTGG - Intronic
933340750 2:81023159-81023181 ATAGTTTTGAGGGTTTCTTTTGG + Intergenic
933432353 2:82199299-82199321 CTTGTTTTTCAGGTTTCTTTGGG - Intergenic
934107828 2:88712092-88712114 CTTGATTTTCAGGTTTTCTTTGG + Intronic
934167881 2:89311839-89311861 TTTGTTTTTCAGATTTCTCTAGG - Intergenic
934199403 2:89870748-89870770 TTTGTTTTTCAGATTTCTCTAGG + Intergenic
934247576 2:90321449-90321471 CTTGTATTTCAGGTTGATTTTGG + Intergenic
934881371 2:97983375-97983397 CTAGTTTTTCAGGTCTCTTCGGG + Intronic
935242044 2:101187333-101187355 CTAGTTTTTCAGGTTAACTCTGG + Intronic
935257546 2:101324951-101324973 CTTGTTTTTCTTGTTTCTTCTGG + Intergenic
935439976 2:103081621-103081643 TCATTTTTTCAGGTTTTTTTTGG - Intergenic
935481669 2:103597112-103597134 CTTGTTTTTCTTGTTTCTCTGGG - Intergenic
935665479 2:105508430-105508452 TCAGTTTTTAAGGTTTCTCTGGG + Intergenic
935740936 2:106147202-106147224 TCAGCTTTTCAGGTTTCTCTGGG - Intronic
935816307 2:106849267-106849289 TCAGTTTTTCATGTTTCTCTGGG - Intronic
935850602 2:107214839-107214861 TCAGTTTTTCAGGTTACTCTGGG + Intergenic
935935439 2:108177454-108177476 CTACTTTTTTAGGTTAGTTTAGG + Intergenic
936035029 2:109104391-109104413 ACAGTTTTTCAGGTTTCTTTGGG + Intergenic
936273945 2:111075626-111075648 CTTGTTTTTCTAGTTTCTTGAGG + Intronic
936771687 2:115921037-115921059 TCAGTTTTTCAGGTTTATTTGGG + Intergenic
936800839 2:116263237-116263259 CTTATTTTTCAAGTTTCTTAGGG - Intergenic
936847648 2:116855915-116855937 CTAGATTTTCTGGTTTATGTGGG - Intergenic
936882786 2:117274770-117274792 CTAGTTTTTCAAGACTGTTTTGG + Intergenic
936965721 2:118125955-118125977 CTAGTTTTGCAGGTTTCCTGTGG - Intergenic
937515322 2:122648295-122648317 CTTCTTTTTCTGGTTTCTTGTGG + Intergenic
937522189 2:122725362-122725384 CTGATTTTTCAGGTTAATTTTGG - Intergenic
937577518 2:123442057-123442079 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
937616891 2:123935057-123935079 GTTGGTTTTCAGGTTTCTCTTGG + Intergenic
937621204 2:123989456-123989478 CTAATTTTTCAGTTTTCTAATGG - Intergenic
937651805 2:124327416-124327438 CTAGTTTTTCAGGTTGACCTTGG - Intronic
937874632 2:126812900-126812922 CTTCTTTTTCAAGTTTGTTTCGG + Intergenic
938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG + Intergenic
938171868 2:129085834-129085856 CTAGGTTTTCAGATTTACTTGGG - Intergenic
938259755 2:129887140-129887162 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
938661369 2:133490301-133490323 CTAGTTTTTCTAGATCCTTTAGG + Intronic
938719646 2:134054957-134054979 TTAGTTTTTCAGGCTTCCCTTGG + Intergenic
939412515 2:141848188-141848210 ATAGGTTTTCAGGTTTATCTTGG - Intronic
939676284 2:145076359-145076381 TTAGATTTTCAGGTTTACTTGGG - Intergenic
939727592 2:145742312-145742334 CTAGGATTTCAGGTTTTTGTAGG - Intergenic
939943898 2:148385340-148385362 GTATTTTTTCATGTGTCTTTTGG - Intronic
939948670 2:148441866-148441888 GTATTTTTTCATGTGTCTTTTGG + Intronic
940016270 2:149108770-149108792 CTTATTTTTCTGGCTTCTTTTGG + Intronic
940100976 2:150038183-150038205 CTTGTTTTTCTAGTTTCTTTAGG - Intergenic
940406917 2:153314851-153314873 CCTTTTTTTCAGGTTTCTTAAGG - Intergenic
940505989 2:154553881-154553903 TTATGTTTTCAGGTTTATTTTGG - Intergenic
940571194 2:155436644-155436666 CTTATTTTTCTAGTTTCTTTAGG + Intergenic
940665706 2:156606573-156606595 GTACTTTTTCAGAATTCTTTTGG + Intronic
940999787 2:160189584-160189606 CCATTTTTTCATGTGTCTTTTGG - Intronic
941048975 2:160709848-160709870 CTTGTTTTTCTAGTTCCTTTAGG + Intergenic
941126534 2:161590786-161590808 GTATTTTTTCATGTGTCTTTTGG + Intronic
941153316 2:161941842-161941864 TCAGTTTTTAAGGTTTCTCTGGG + Intronic
941596641 2:167485097-167485119 CAAGTTTTTCAGGTTTACTTTGG + Intergenic
941679862 2:168385926-168385948 ATGGTTTTGCAGGTTCCTTTTGG - Intergenic
941704060 2:168639202-168639224 CTAGCTTTACAGGCTTCCTTTGG + Intronic
941907898 2:170734750-170734772 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
941925486 2:170890035-170890057 CTAGTTTTATAGTTTTATTTCGG + Intergenic
942097739 2:172549219-172549241 CTAGTTTCTCAGGTTAACTTTGG - Intergenic
942294097 2:174500826-174500848 GTAGTTTTTCAGGTTTCTTTGGG + Intergenic
942295283 2:174510932-174510954 GTAGTCTCTCAGGTTTCTTTGGG + Intergenic
942339169 2:174925152-174925174 TCAGTTTTTCAGGTTTCTTTGGG - Intronic
942358694 2:175148520-175148542 CTAGTTTTTCGGGTTAACTTTGG - Intronic
942370221 2:175276021-175276043 CAAGTTTTCCAAGTCTCTTTAGG + Intergenic
942416306 2:175762839-175762861 CTAGATTTTCTAGTTTATTTGGG - Intergenic
942543743 2:177041305-177041327 CTAGTTTCTCAGGTTAACTTTGG - Intergenic
942605030 2:177681680-177681702 CTAGCATTTCAGGTTAATTTAGG - Intronic
942746112 2:179235015-179235037 TTGGTTTTTCATGTCTCTTTAGG - Intronic
942762335 2:179413853-179413875 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
942851344 2:180491414-180491436 GTAGTTTCTGAAGTTTCTTTTGG + Intergenic
942945385 2:181666577-181666599 CTAGTTTTTCAGGTTAACTTTGG - Intronic
943284233 2:185976764-185976786 GTATTTTTTCATGTTTTTTTTGG - Intergenic
943530202 2:189070253-189070275 TTAGTTTTCCAGGCCTCTTTAGG - Intronic
943580702 2:189680734-189680756 ATAGTTTTGCGGGTTCCTTTTGG + Intronic
943581537 2:189689303-189689325 TTAGTTTTTAAGGTTTCTTTGGG + Intronic
943849041 2:192692628-192692650 GTATTTTTTCATGTGTCTTTTGG - Intergenic
943909526 2:193545080-193545102 ATAGTTTTGAAGGTTCCTTTTGG - Intergenic
944004618 2:194889559-194889581 CAAATTTTTCAGATTTGTTTAGG - Intergenic
944069544 2:195653666-195653688 CTAGTGTTTCAGGTTAACTTTGG + Intronic
944251591 2:197584374-197584396 CCATTTTTTCATGTGTCTTTTGG + Intronic
945013599 2:205490873-205490895 CCATTTTTTCATGTGTCTTTTGG + Intronic
945014864 2:205504620-205504642 CCATTTTTTCATGTGTCTTTTGG - Intronic
945480938 2:210344981-210345003 CTTGTTTCTCAGGTTCCTTGGGG + Intergenic
945811340 2:214553771-214553793 CTAGTTTTTCAGGTTAACTTTGG + Intronic
945811413 2:214554330-214554352 CTAGTTTTTCAGGCTTACTTTGG - Intronic
946546639 2:220751108-220751130 CTAGATTTTCTAGTTTATTTGGG + Intergenic
946799482 2:223396850-223396872 CTAGTTTTTCAGATTTTTAAAGG + Intergenic
947014563 2:225604214-225604236 CTATGTTTTCAGCTTTTTTTAGG - Intronic
947086846 2:226462393-226462415 CTTGTTTTTAAGATTACTTTAGG - Intergenic
947267078 2:228294676-228294698 CTATTTTTTCTGCTTTCTTATGG - Intergenic
947570383 2:231229046-231229068 CCAGTTTTTAAGCCTTCTTTAGG + Intronic
947618179 2:231571903-231571925 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
947660868 2:231866583-231866605 CTTCTTTTTCAGGATTGTTTTGG - Intergenic
947814656 2:233028345-233028367 CTAGTTTTTCAGGTTAACTTGGG - Intergenic
947894481 2:233656748-233656770 TCAGTTTTGAAGGTTTCTTTGGG + Intronic
947949710 2:234136546-234136568 CTAGTTTTTCAGGTTAGCTTTGG - Intergenic
947996303 2:234530578-234530600 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
948620271 2:239230204-239230226 CTCATTTTTCAAGTTTCTTTGGG + Intronic
948633136 2:239314868-239314890 CTAGCTTTTCAGGTTAATGTTGG - Intronic
948672985 2:239580461-239580483 CTTGTTTTTCTCTTTTCTTTAGG - Intronic
948717977 2:239877894-239877916 CTAATTTTTCAGGTTAACTTGGG + Intergenic
948746546 2:240099039-240099061 ATAGTTTTGAGGGTTTCTTTTGG - Intergenic
1168845870 20:944419-944441 CTAGATTTTCAGGGTTTGTTGGG + Intergenic
1169160936 20:3377862-3377884 CTCGTTTTTCAAGTTTACTTTGG + Intronic
1169173644 20:3488662-3488684 GTTCTTTTTCAGGTTTATTTTGG + Intronic
1169237156 20:3939649-3939671 CTTCTTTTTCAAGATTCTTTTGG + Intronic
1169302806 20:4459226-4459248 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1169407041 20:5330469-5330491 TCAGGTTTTAAGGTTTCTTTGGG + Intergenic
1169601103 20:7261679-7261701 CAATTTTTTCATGTGTCTTTTGG + Intergenic
1169628070 20:7595166-7595188 CTATTTTTTCATGTGTTTTTTGG + Intergenic
1169650719 20:7864302-7864324 CCAGTTTTTCAAGTTCCTTATGG - Intergenic
1170074575 20:12405561-12405583 CTAATTTTTCAGGTTAACTTTGG + Intergenic
1170098572 20:12673809-12673831 GTAATTTTTAAGGTTTATTTTGG - Intergenic
1170716663 20:18837597-18837619 TCAGTTTTTTAGGTTTCTCTGGG - Intergenic
1170823760 20:19776139-19776161 CTAGTTTTTCTGGTTAACTTTGG - Intergenic
1170826961 20:19805003-19805025 CTAGATTTTCTAGTTTATTTAGG + Intergenic
1170930730 20:20767872-20767894 CTACTTTTTCAGGTTAACTTTGG + Intergenic
1171081363 20:22188566-22188588 ATGGTTTTGAAGGTTTCTTTTGG + Intergenic
1171235654 20:23522256-23522278 CTAGTGTTTCAGTTTTACTTTGG + Intergenic
1171770913 20:29322532-29322554 ATATTTTTTTATGTTTCTTTTGG + Intergenic
1171818255 20:29808248-29808270 CTAGCTTTTCAGGTTAACTTTGG - Intergenic
1171899546 20:30844730-30844752 CTAGCTTTTCAGGTTAACTTTGG + Intergenic
1172429746 20:34879540-34879562 TTAGTTTTTCTGGGTTTTTTTGG - Intronic
1173535352 20:43806726-43806748 CTTATTTTTCTGGTTTCTTAAGG + Intergenic
1173711530 20:45161041-45161063 CTTCTTGTTCAGGATTCTTTTGG - Intergenic
1173772136 20:45669752-45669774 CTTGTTTTTCAAGTTCCTCTAGG - Intronic
1173887962 20:46478631-46478653 CTAGTTTTTCAGGTTAACTTCGG + Intergenic
1173888089 20:46479373-46479395 TTCATTTTTCAGGTTTCTCTTGG - Intergenic
1174101876 20:48133106-48133128 CTTGTTTTTCAAGATTATTTTGG + Intergenic
1174119364 20:48250739-48250761 TCAGTTTTTCAGGTTTCTCTAGG - Intergenic
1174143422 20:48433109-48433131 CTAGTGTTTCAGGTTGATTTAGG - Intergenic
1174323410 20:49760238-49760260 CTAGTTTTTCAGGTTTTCTTTGG - Intergenic
1174435112 20:50500811-50500833 CTAGTTTTTCAAGTTTTTGAAGG - Intergenic
1174490890 20:50894512-50894534 CTAGTTTTTGTGTTTACTTTAGG - Exonic
1174888579 20:54363967-54363989 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
1175770142 20:61618328-61618350 GTTGTTTTTCAGGTTTCTCTGGG + Intronic
1176036504 20:63041273-63041295 CTTCTTTTTCTTGTTTCTTTTGG + Intergenic
1176363704 21:6019802-6019824 CTTGTTTTTCAGGTTAGCTTTGG + Intergenic
1176738111 21:10571436-10571458 CTTGCTTTTCACGTTTCTTATGG - Intronic
1176813545 21:13572123-13572145 GTAGTTTTTTTGTTTTCTTTTGG - Intergenic
1177132629 21:17276781-17276803 ATATTTTTTCAGGTGTCTTTTGG - Intergenic
1177191848 21:17860898-17860920 CTAGTTTTTCAGGTTAATTTTGG + Intergenic
1177196082 21:17904919-17904941 CTATGTATTCAGGTATCTTTCGG + Intronic
1177276435 21:18918454-18918476 TTAATTTTTAAGGTTTCTTTGGG - Intergenic
1177294076 21:19152444-19152466 GTATTTTTTCATGTGTCTTTTGG - Intergenic
1177306635 21:19326970-19326992 CTACTTTTTCAGTTTTATATAGG + Intergenic
1177385840 21:20408474-20408496 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1177450720 21:21261792-21261814 CTTGTTTTTCTAGTTTCTTAAGG - Intronic
1177517017 21:22166552-22166574 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
1177619453 21:23568277-23568299 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1177878626 21:26666299-26666321 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1178023212 21:28433841-28433863 ATAGTTTTTCAGTTTTTTTGTGG - Intergenic
1178094513 21:29199140-29199162 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1178525630 21:33325927-33325949 CTAGTTTTTCAGATTAACTTTGG + Intronic
1178525896 21:33328407-33328429 GTAGTTTTTCAGGTTAGCTTTGG + Intronic
1178814469 21:35915363-35915385 CTTGTTTTTCAGGTTAACTTTGG + Intronic
1178897395 21:36570418-36570440 CTAGTTTTTTAGGTTGACTTTGG + Intronic
1179006030 21:37516038-37516060 CCAGTTTCTCAGTTTCCTTTGGG + Intronic
1179268636 21:39829679-39829701 ATGGTTTTGCAGGTTGCTTTTGG + Intergenic
1179345432 21:40551883-40551905 CTACCTTTTCAGGTTTCCTTGGG + Intronic
1179371919 21:40813943-40813965 CCAGTTTTGACGGTTTCTTTTGG + Intronic
1179393817 21:41019236-41019258 CTATATTTTCAGGTTTACTTAGG - Intergenic
1179417550 21:41210256-41210278 TAAGTTTTTAAGGTTTTTTTGGG - Intronic
1179448927 21:41454459-41454481 TCAGATTTTCAGGTTTCTCTGGG + Intronic
1179620004 21:42607874-42607896 CTAGCTTTTCAGGTTAACTTTGG - Intergenic
1179731585 21:43370969-43370991 CTCGTTTATCAGGTTCCTTTGGG - Intergenic
1179759814 21:43518743-43518765 CTTGTTTTTCAGGTTAGCTTTGG - Intergenic
1180094149 21:45547341-45547363 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
1180321694 22:11327655-11327677 CTAGCTTTTCAGGTTAACTTTGG - Intergenic
1180333358 22:11553011-11553033 CTAGCTTTTCAGGTTAACTTTGG + Intergenic
1180558133 22:16593759-16593781 CTTGTGTATCAGGTTTCTTAGGG + Intergenic
1180653030 22:17394611-17394633 CTCCTTTTTCAGGATTATTTTGG + Intronic
1180866767 22:19124250-19124272 ATAGTTTTTCAGGTTAAGTTTGG + Intergenic
1180873269 22:19160006-19160028 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
1181451267 22:23023510-23023532 CTGGTTTTTCAGCTTTACTTTGG - Intergenic
1181452312 22:23031739-23031761 CTAGCTTTTCAGGTTTACTTTGG - Intergenic
1182124449 22:27806270-27806292 CTAGTTTCTCATGTTTGTGTGGG - Intergenic
1182646946 22:31817652-31817674 CTAGTTTTTAAAGTTTTTGTAGG + Intronic
1182800997 22:33031798-33031820 TCAGTTTTTCAGGTTTCTCTGGG - Intronic
1183103017 22:35595365-35595387 CTATTTTATCAGGTTTACTTTGG - Intergenic
1183611142 22:38907176-38907198 ACAGTTTTTCAGGTTCCTTTCGG - Intergenic
1183839927 22:40490742-40490764 TGAGTTTTCCAGATTTCTTTGGG - Intronic
1183873018 22:40754782-40754804 ATGGTTTTTCAGGTTTACTTTGG - Intergenic
1185214683 22:49591659-49591681 CTAGTGTTTCAGGCTTACTTTGG - Intronic
1185240920 22:49746152-49746174 CTTGATTTACAGGTTTGTTTGGG + Intergenic
1203292763 22_KI270736v1_random:11215-11237 CTAATTTATCAGATTTTTTTAGG - Intergenic
949095096 3:76465-76487 TTAGTTTTTCAGTTTTCTCTGGG - Intergenic
949403342 3:3688508-3688530 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
949406786 3:3722615-3722637 CTAGATTTTCTAGTTTATTTGGG - Intronic
949462613 3:4309318-4309340 CTAGTTTTTCAGGTTAGCTTTGG + Intronic
949629696 3:5911114-5911136 CTTGTTTTTCTAGTTTCTCTGGG + Intergenic
949647412 3:6111923-6111945 CTATTTCTTCAGTTTCCTTTTGG + Intergenic
949927592 3:9054184-9054206 CTAGTTTTTCAGGTTAACTTTGG - Intronic
950381060 3:12615622-12615644 TTAGTTTTGCCTGTTTCTTTGGG - Intronic
950470549 3:13182861-13182883 CTACTTTTTCTAATTTCTTTGGG - Intergenic
950917363 3:16659553-16659575 CTAGTTTTTCAGGTTTACTTTGG - Intronic
950919711 3:16681971-16681993 GCAGTTTTTCATGTGTCTTTTGG - Intergenic
950920651 3:16690686-16690708 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
951005752 3:17613646-17613668 GTATTTTTTCATGTTTCTGTTGG + Intronic
951127340 3:18999191-18999213 TTTGTCTTTCAGGTTTCTTTTGG + Intergenic
951356251 3:21670708-21670730 TCAGTTTTCAAGGTTTCTTTGGG - Intronic
951453697 3:22867494-22867516 CTGTGTTTTCAAGTTTCTTTTGG - Intergenic
951572245 3:24076717-24076739 ATAGTTTTGAAGGTTCCTTTTGG + Intergenic
951767108 3:26212319-26212341 CTTGTTTTTCAAGTTCCTCTAGG + Intergenic
952033807 3:29175902-29175924 CTAGTGTTTCAGGTTAGTTTTGG + Intergenic
952161973 3:30703001-30703023 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
952291025 3:32015827-32015849 GTATTTTTTCAAGTGTCTTTTGG - Intronic
952628730 3:35439509-35439531 CCAGTTTTTCAGGTTTCTCTGGG + Intergenic
952984616 3:38767541-38767563 ATAGTTTTGAGGGTTTCTTTTGG + Intronic
952993941 3:38858860-38858882 ATAGTTTTGAAGGTTCCTTTTGG - Intronic
953066696 3:39479329-39479351 CTAGAATTACAGGGTTCTTTTGG + Intronic
953178155 3:40570835-40570857 CCAGTTTTTCAGGTTTCTTTGGG + Intronic
953320004 3:41962905-41962927 CTAGTTCTTCAGGTTAACTTTGG - Intergenic
953359379 3:42281374-42281396 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
953454043 3:43028337-43028359 CCAGTTTTTCAGGTTAACTTTGG + Intronic
953505396 3:43481467-43481489 CTAGTTTTTCAGGTTAGCTTTGG - Intronic
953602568 3:44382157-44382179 CTTCTTTTTCAGGATTGTTTTGG - Intronic
953855491 3:46496663-46496685 TTAGTTTTTCAGGTTTCTCAGGG + Intergenic
953988677 3:47466213-47466235 CTTGTTTTTCAAGTTTGTTTTGG - Intronic
954591288 3:51785372-51785394 ATACTTTTTCTAGTTTCTTTAGG + Intergenic
954720350 3:52556697-52556719 ATGGTTTTACAGGTTTCTTAGGG - Intronic
954923514 3:54212668-54212690 TTAGTTTTTCAGGTTAACTTTGG + Intronic
954969805 3:54641849-54641871 GTACTTTTTCAGATTTCTTTGGG + Intronic
954995547 3:54878127-54878149 CTAGTGTTGCAGTTTTCTATCGG + Intronic
955126109 3:56114500-56114522 TCAGTTTTTAAGGTTTCTCTGGG + Intronic
955381529 3:58442281-58442303 CTTGTTTTTCAGGTTGTCTTGGG + Intergenic
955414656 3:58680833-58680855 TTTGATTTTCAGATTTCTTTAGG - Intergenic
955455154 3:59112244-59112266 ATTGTTTTTCAGGTTATTTTAGG - Intergenic
955867331 3:63398905-63398927 GCAGTTTTTAAGGATTCTTTTGG + Intronic
955909768 3:63847893-63847915 CTAGTTTTTCAGGTTTACTTTGG - Intronic
956262766 3:67363161-67363183 ATACTATTTCAGGGTTCTTTTGG - Intronic
956372964 3:68583883-68583905 CTAGATTTTCTGGTTTATTTGGG + Intergenic
956523553 3:70132021-70132043 TCAGTTTTTAAGGTTTCTCTAGG - Intergenic
956544707 3:70387966-70387988 CTATTTTTTTTGGTTTGTTTTGG + Intergenic
956716073 3:72081184-72081206 CTAGTTTTTCTGGTTAACTTTGG + Intergenic
956909175 3:73799576-73799598 ATATTTTTTCAGGGTTCTGTGGG + Intergenic
957181117 3:76878746-76878768 CTAATTTTTAAGGTATCTCTGGG - Intronic
957185194 3:76932520-76932542 CTAGTTTTTCCCTTTTCTTTTGG + Intronic
957189024 3:76982524-76982546 CTTGTTTTTCAAGATTGTTTTGG + Intronic
957483906 3:80832982-80833004 CTAGTTTTTCAGGTTTAGATGGG - Intergenic
957489633 3:80906991-80907013 CCATTTTTTCATGTGTCTTTTGG - Intergenic
957575329 3:82000371-82000393 TTATTTTTTCATGTTTATTTAGG + Intergenic
957653542 3:83039717-83039739 GTAGTGTTTCAGGCTTCTTAGGG - Intergenic
957678140 3:83396677-83396699 CTTGTTTCTCAAGTTTCTTCAGG - Intergenic
957965242 3:87313636-87313658 CTAATTTTTCAGGTTAACTTTGG + Intergenic
957998978 3:87727822-87727844 CTAATTTTTCAGGTTAACTTTGG - Intergenic
958011178 3:87882090-87882112 CCATTTTTTCATGTGTCTTTTGG - Intergenic
958673437 3:97234041-97234063 AGAGTTTTACAGATTTCTTTGGG + Intronic
958741043 3:98072526-98072548 ATTGTTTTTCAGGTTTTATTTGG + Intergenic
958763120 3:98331947-98331969 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
958770903 3:98424394-98424416 CTGGTTTTGAAGGTTGCTTTTGG - Intergenic
958828560 3:99061429-99061451 CTAGATTTTCTAGTTTATTTGGG + Intergenic
958898349 3:99855758-99855780 TTAGTTTTTCAACATTCTTTTGG - Intronic
959053047 3:101542621-101542643 CTAGTTTTTCAGATTAATTTTGG + Intergenic
959241326 3:103798479-103798501 GTAGTTTTTCAGGTTGTCTTTGG + Intergenic
959343091 3:105156589-105156611 TCAGTTTTTCAGGTTTCTCTAGG - Intergenic
959376595 3:105595217-105595239 CTAGCTTTTCAGGTTTCTTTTGG + Intergenic
959381630 3:105648174-105648196 CTAGTTTTTCAGATTGGATTAGG - Intergenic
959499163 3:107085620-107085642 CCAGTTTTTAAGGTTTCTCTGGG + Intergenic
959655409 3:108798840-108798862 CTAGTTTCACATTTTTCTTTTGG + Intergenic
959678065 3:109059553-109059575 CTAATTTTTCACTTTTTTTTTGG + Intronic
959715501 3:109428771-109428793 ATGGTTTTGAAGGTTTCTTTTGG + Intergenic
959722067 3:109503147-109503169 ATTGTTTTAAAGGTTTCTTTTGG + Intergenic
959740356 3:109711568-109711590 GTATTTTTTCATGTGTCTTTTGG - Intergenic
959756738 3:109908585-109908607 ATGGTTTTGAAGGTTTCTTTTGG + Intergenic
959862796 3:111235073-111235095 CTAGCTTTTCAGGTTTCTTGGGG + Intronic
959876412 3:111387910-111387932 CTTGCTTTTCTGTTTTCTTTAGG - Intronic
959998312 3:112702566-112702588 ATAGTTTTGAAGGTTCCTTTTGG - Intergenic
960014386 3:112870540-112870562 ATTGTTTTTCTGATTTCTTTGGG + Intergenic
960110169 3:113838118-113838140 CTAGATTTTCAGGTTAAATTTGG + Intronic
960244596 3:115386349-115386371 CTAGTTTCTCACATTTCTTATGG - Intergenic
960425988 3:117508498-117508520 CCAGTTTTTCATGTTTCTTTGGG + Intergenic
960547326 3:118930913-118930935 CTTATTTTTCAGTATTCTTTTGG - Intronic
960746572 3:120896965-120896987 GTATTTTTTCATGTGTCTTTTGG + Intergenic
960761798 3:121079628-121079650 ATAGTTTTGAAGGTTCCTTTTGG + Intronic
960907397 3:122615099-122615121 CTTTCTTTTCAGGTATCTTTGGG - Intronic
961227586 3:125266654-125266676 CTTGTTTTTCTAGTTCCTTTAGG - Intronic
961245578 3:125449909-125449931 CTGGTCTTTCAGATTTCTTGAGG + Intronic
961348930 3:126286815-126286837 CAAGTTTTTCAGGTTAACTTTGG + Intergenic
961470859 3:127111092-127111114 CTAGGTTTTCAGGTTTCTTTGGG - Intergenic
961689839 3:128661235-128661257 ATAATGTTTCAGGTTTATTTTGG + Intronic
961791449 3:129379489-129379511 CTAGTTTTTTAGGGGTTTTTTGG + Intergenic
961794245 3:129398162-129398184 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
961835209 3:129652364-129652386 TCACTTTTTCAGGTTTCTTTGGG - Intronic
961842830 3:129731784-129731806 CTAGTTTTTCGTATTTTTTTTGG + Intronic
962767497 3:138579258-138579280 ATAGTGTTTCAAGTTTATTTAGG - Intronic
962934906 3:140071387-140071409 CTTGTTTTTCATGTCTCTGTTGG - Intronic
962983364 3:140510517-140510539 ATGGTTTTTCAGGATTGTTTTGG + Intronic
963213449 3:142719569-142719591 ATAGTTTTGAAGGTTCCTTTTGG - Intergenic
963226542 3:142868346-142868368 CTAGTTTTTCAGGTTAGCTTTGG - Intronic
963451621 3:145489654-145489676 CTATTTTTTAAAATTTCTTTTGG + Intergenic
963611008 3:147468284-147468306 CTAGTTTTTAAAATTTTTTTTGG + Intronic
963756458 3:149239596-149239618 TTAGTTTTTCAGGTTAACTTAGG + Intergenic
963809296 3:149758901-149758923 ATTGTTTTTCAAGTTTGTTTTGG - Intergenic
963842174 3:150119019-150119041 CTAGCTTTTCAGGTTTCTTTGGG - Intergenic
963891610 3:150641842-150641864 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
963910538 3:150813861-150813883 TTAGTTTTTCAGGTTTTTGGGGG + Intergenic
964222806 3:154366137-154366159 TCAGTTTTTCAGGTTTCTCTAGG - Intronic
964260369 3:154828615-154828637 CTTGTTTTTCAGATTTACTTTGG + Intergenic
964260954 3:154836034-154836056 TCAGTTTTTCAGGTTTCTTTGGG + Intergenic
964543076 3:157801280-157801302 CTAGGTTTTCTAGTTTATTTGGG + Intergenic
964695106 3:159498844-159498866 CTTATTTTACAGGCTTCTTTGGG + Intronic
964854988 3:161137114-161137136 ATAGTTTTTCAGCTTTCTCTGGG + Intronic
964856117 3:161147696-161147718 CTAGTTTTTCAGGTTAACATTGG + Intronic
964916101 3:161844032-161844054 ATGGTTTTGAAGGTTTCTTTAGG + Intergenic
964974713 3:162604968-162604990 CTCGTTTTTCCAGTTTCTCTGGG - Intergenic
965000818 3:162950730-162950752 ATAGTTTTGAAGGTTTCTTTTGG - Intergenic
965088807 3:164136280-164136302 GCAGTTTTTCATGTGTCTTTTGG - Intergenic
965185308 3:165455093-165455115 CTAGGGTCTCAGGTTTCTATGGG + Intergenic
965197502 3:165620705-165620727 CTAGTTTTTCAGGTCAACTTTGG - Intergenic
965291213 3:166883898-166883920 ATAGTTTTAGGGGTTTCTTTTGG - Intergenic
965320442 3:167247146-167247168 CTAGTGTCTCAGGTTTTTATAGG - Intronic
965435043 3:168639995-168640017 GCATTTTTTCATGTTTCTTTTGG - Intergenic
965593862 3:170388003-170388025 CTATATTTTCAGTTTTTTTTTGG + Intronic
965982805 3:174713564-174713586 GTACTTTTTCATGTGTCTTTTGG + Intronic
966395787 3:179501462-179501484 CTAATTTTTGGGGTTTGTTTTGG + Intergenic
966408080 3:179619958-179619980 ATATTTTTTCATGTGTCTTTTGG + Intronic
966614544 3:181899182-181899204 CTAGTTTTTCAGTATTCTTAAGG - Intergenic
966675679 3:182585803-182585825 CTAGTTTTTAAAGTTGTTTTGGG - Intergenic
966824914 3:183955453-183955475 ATAGATTTTCAGGTTCCATTGGG + Intronic
967195625 3:187023080-187023102 TCAGTTTTTCAGGTTTCTCTGGG + Intronic
967203536 3:187097700-187097722 ATAGTTTTGAAGGTTCCTTTTGG - Intergenic
967476491 3:189926942-189926964 CTAATTATTCAGGTGACTTTGGG - Intergenic
967543244 3:190693552-190693574 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
967544045 3:190702608-190702630 TTAGTTGCTCAGGTTTCTTTGGG - Intergenic
967598712 3:191358686-191358708 ATTATTTCTCAGGTTTCTTTTGG + Intronic
968356946 3:198116030-198116052 CTAGCTTTTCAGGTTAACTTTGG + Intergenic
968860342 4:3163685-3163707 CTAGATTTTCTAGTTTATTTGGG + Intronic
969198962 4:5586454-5586476 CTGGTTTTTCAGGTTGACTTTGG - Intronic
969272440 4:6111982-6112004 CTAGCTTTTCAGGTTAACTTTGG - Intronic
969346312 4:6572555-6572577 CTAGTTTTTTGGGTTTCTTTGGG - Intergenic
969634350 4:8357909-8357931 CTGGTTTTTCAGGTTTCTTTGGG - Intergenic
969661529 4:8532455-8532477 CTGGTTTTTCAGGTTAACTTTGG + Intergenic
969661796 4:8534386-8534408 CTAGTTTTTCAGGTTTACGTTGG - Intergenic
970067314 4:12113474-12113496 CTTGTTTTTCAAGTTCCTGTAGG + Intergenic
970205674 4:13653498-13653520 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
970276233 4:14404119-14404141 TTAGTTTTTCAGGTTTCATTGGG + Intergenic
970653972 4:18210684-18210706 CTTGTTTTTCAAGTTCCTCTAGG + Intergenic
970857030 4:20660841-20660863 CCATTTTTTCATGTGTCTTTTGG + Intergenic
970934443 4:21552718-21552740 TTAGTTTTTTAGGCTTCTGTTGG + Intronic
971117336 4:23663915-23663937 TTTGTTTTTCAGGTTTTTCTGGG + Intergenic
971729433 4:30358567-30358589 CTTGTTTTTCAAGTTCCTTTAGG + Intergenic
971998087 4:33993350-33993372 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
972293438 4:37713699-37713721 CTCATTTTTCAGGTTTACTTTGG + Intergenic
972523974 4:39890150-39890172 AGAGGTTTTCAGGTATCTTTAGG + Intronic
972591352 4:40490957-40490979 CTTCTTTTTCAAGTTTGTTTTGG - Intronic
972753821 4:42023138-42023160 CTAGTTGTTTAGATTTCATTTGG + Intronic
973244286 4:47993980-47994002 ATGGTTTTGAAGGTTTCTTTTGG + Intronic
973336607 4:48962857-48962879 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
973336878 4:48965605-48965627 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
973787297 4:54344294-54344316 ATGGTTTTGAAGGTTTCTTTTGG - Intergenic
973920202 4:55676213-55676235 ATTGTTTTTCTGGTTCCTTTGGG - Intergenic
973975277 4:56256840-56256862 CTAGTTTTTCAGGTTTACTTTGG - Intronic
974027290 4:56744863-56744885 CAAGTTTTTAAGGTTTCTCTGGG - Intergenic
974633903 4:64533490-64533512 CTACTTTTTCAGGTTTTTTGGGG + Intergenic
974696970 4:65388578-65388600 GTATTTTTTCATGTGTCTTTTGG + Intronic
974760667 4:66269625-66269647 CTAGATTTTCTAGTTTATTTGGG - Intergenic
974772812 4:66437600-66437622 CTAGTTTTTCAGATTTCTTTGGG - Intergenic
974777914 4:66511114-66511136 TTAGTTTTTAAGGTTTTTCTTGG - Intergenic
974935230 4:68403602-68403624 CTAGTGTTTCAGGTTAACTTTGG - Intergenic
974974578 4:68874307-68874329 CTAGCTTTTCAGGTTAACTTTGG - Intergenic
974997833 4:69184103-69184125 GCATTTTTTCATGTTTCTTTTGG + Intronic
975059892 4:69984756-69984778 TTACTTTTTCAGGTTTACTTTGG + Intergenic
975066067 4:70064874-70064896 CTAGTTTTTCAGGTTAGCTGTGG + Intergenic
975080933 4:70280135-70280157 CTAGTTTATCAAGTTTATCTAGG - Intergenic
975188046 4:71426265-71426287 CTAGTTTTTCAGGTTAACTTTGG + Intronic
975206250 4:71646955-71646977 TCAGTTTTTCAGATTTCTCTGGG + Intergenic
975222408 4:71828170-71828192 CTAGTTTTTCAGGTTAACTTCGG + Intergenic
975253014 4:72201222-72201244 ATAATTTTCCAGGTTTCTTGTGG + Intergenic
975390090 4:73805955-73805977 CTTGTTTTTCTAGTTTCTCTAGG - Intergenic
975435522 4:74346480-74346502 TTAGTTTTTCAGTTTTCTCTGGG + Intergenic
975614861 4:76236141-76236163 CCAGTTTGACAGGTTTCTGTTGG - Intronic
975672455 4:76795246-76795268 ATAGTTTTTCCTGTTTCTTTGGG - Intergenic
975771288 4:77725677-77725699 TAAGTTTTTCAGGTTATTTTTGG - Intronic
976112081 4:81686334-81686356 CAAGTTTTTCAGGTTAATTTTGG + Intronic
976337216 4:83903597-83903619 TCAGTTATTCAGTTTTCTTTTGG + Intergenic
976374999 4:84336102-84336124 CTTGTTTTTCTAGTTCCTTTAGG + Intergenic
976469308 4:85409090-85409112 TTAGTTTTTAATGTTTCTGTTGG + Intergenic
976556435 4:86455995-86456017 CTGGTTTTGAAGGTTCCTTTTGG - Intronic
976742574 4:88371771-88371793 CTTGTTTTTCTGGTCTCTTGGGG - Intergenic
976869792 4:89777296-89777318 ATAGTTTTGAGGGTTTCTTTTGG - Intronic
976885435 4:89978037-89978059 TCAGTTTTTAAGGTTTCTTTGGG - Intergenic
977578202 4:98697077-98697099 CTAGTTTTTCAGGTTTCTTTAGG - Intergenic
977681334 4:99801621-99801643 CTAGTTTTTCAAGTTAACTTTGG + Intergenic
977932701 4:102765842-102765864 CTAGCTTTTCAGGTTAACTTTGG + Intergenic
977948263 4:102938958-102938980 CTCGTTTTTCTGTTTCCTTTAGG - Intronic
977989725 4:103426229-103426251 CCTGTTTTACAGGTTTCTTGGGG - Intergenic
977992955 4:103466728-103466750 CCAGTTTTTTAGGTTAATTTTGG + Intergenic
978043966 4:104103851-104103873 ATAGTTTTGGGGGTTTCTTTTGG - Intergenic
978200774 4:106021739-106021761 CCAGTTTTTAAGGTTTTTCTGGG - Intergenic
978320334 4:107486501-107486523 CTTGTTTTTCTGGTTCCTTGAGG - Intergenic
978663818 4:111158529-111158551 CTTGTTTTTCTAGTTTCTTGAGG - Intergenic
978680340 4:111373501-111373523 CTAGTTTTTCAATGTTATTTAGG - Intergenic
978942842 4:114458136-114458158 GTAGTTTTTCAGGTTCCTTTGGG + Intergenic
979015099 4:115422387-115422409 ATTGTCTTTTAGGTTTCTTTAGG + Intergenic
979372290 4:119903564-119903586 GTTCTTTTTCAGGATTCTTTTGG - Intergenic
979457910 4:120947446-120947468 CTAGATTTTCTAGTTTATTTGGG - Intergenic
979591022 4:122480382-122480404 TTAGTTTTTAAGGTTTCTCTGGG + Intergenic
979642197 4:123022415-123022437 CCATTTTTTCATGTGTCTTTTGG - Intronic
979648007 4:123094349-123094371 TTAGTTTTTTAGGTTTCTGTAGG + Intronic
979658522 4:123224971-123224993 CCATTTTTTCATGTGTCTTTTGG + Intronic
979706550 4:123726760-123726782 CCATTTTTTCATGTGTCTTTTGG - Intergenic
979777772 4:124612694-124612716 CCATTTTTTCATGTGTCTTTTGG + Intergenic
979862171 4:125707496-125707518 CTAGGTTCTCGGGTTTCTGTAGG + Intergenic
979872454 4:125841104-125841126 CTATTTTTTCAGATTGTTTTCGG + Intergenic
979874273 4:125867650-125867672 CTTGTTTTTCAAGTTCCTTGAGG - Intergenic
979930238 4:126620773-126620795 CTTGTTTTTCTAATTTCTTTAGG - Intergenic
980017813 4:127673480-127673502 CCAGTTTTGAAGCTTTCTTTTGG + Intronic
980032714 4:127848944-127848966 CTTGTTTTTCAGGTTCCTTGAGG - Intergenic
980259807 4:130433584-130433606 CTAGTTTTTCAGGAGTACTTTGG - Intergenic
980264665 4:130499987-130500009 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
980521597 4:133943346-133943368 CTTGTTTTTCAGGTTAACTTTGG + Intergenic
980556780 4:134417843-134417865 CTTTTTATTCAGTTTTCTTTAGG + Intergenic
980625527 4:135370879-135370901 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
980736741 4:136900089-136900111 CTAGATTTTCAGGTTTACTTTGG + Intergenic
980983170 4:139671214-139671236 TCAGTTTTTCAGGTCTCTCTGGG + Intronic
981002153 4:139838292-139838314 CTAGATTTTTAGCTTTATTTTGG + Intronic
981077578 4:140606613-140606635 CTCGTTTTTCAGGTTAACTTTGG - Intergenic
981089215 4:140715278-140715300 CTAGTTTTTCAGGTTTACTTTGG + Intronic
981189633 4:141846994-141847016 CCAGTTTTTCAGGTTTACTTTGG - Intergenic
981637141 4:146893910-146893932 GTATTTTTTCATGTGTCTTTTGG - Intronic
981738772 4:147981121-147981143 CTTGTTTTTCTGGTTTCTTTAGG + Intronic
981805617 4:148711798-148711820 TTAGTTTTTCAGGTTTCCTTTGG + Intergenic
981805996 4:148715829-148715851 CTAGCTTTTCAGGTTAACTTTGG + Intergenic
981850771 4:149227984-149228006 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
981903323 4:149891599-149891621 CTAGTGTTTCAGATTTACTTTGG + Intergenic
982009555 4:151093451-151093473 CTAGTGTTTTAGGTTTACTTTGG + Intergenic
982029794 4:151288932-151288954 CTTGTTTTTCAAGATTGTTTTGG - Intronic
982334924 4:154224529-154224551 CTAGTTATTCAGGTTAACTTTGG - Intergenic
982500703 4:156151477-156151499 CTAGTTTCTCAGGTTCGTTTGGG + Intergenic
982619516 4:157686399-157686421 CTAGTTTTGCAAGTTCCTGTGGG - Intergenic
982867795 4:160540070-160540092 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG + Intronic
983097134 4:163576099-163576121 CTTGTTTTTCTAGTTTCTGTAGG + Intronic
983174154 4:164568471-164568493 CCATTTTTTCATGTGTCTTTTGG - Intergenic
983476793 4:168221871-168221893 GTATTTTTTCAGGTTACTCTAGG - Exonic
983491542 4:168396090-168396112 CCAGTTTTTCAGCCTTCTTTGGG + Exonic
983513034 4:168629366-168629388 GTAGACTTCCAGGTTTCTTTTGG - Intronic
983691940 4:170481502-170481524 TCTGTTTTTCAGGTTTCTCTAGG + Intergenic
983704638 4:170642628-170642650 CTAGATTTTCTAGTTTATTTGGG - Intergenic
983778852 4:171643024-171643046 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
983847968 4:172542670-172542692 TTTGTTTTTCGGGTTTCTCTGGG + Intronic
984008289 4:174340069-174340091 CTAGTTTTACAGGTTAACTTTGG + Intergenic
984086763 4:175323153-175323175 GTAGTTTCTCAGGTTTCTTTGGG - Intergenic
984240900 4:177218309-177218331 TCAGTTTTTCAGATTTCTCTTGG - Intergenic
984636223 4:182112476-182112498 CTAGTTTATAAGATTTCATTGGG + Intergenic
984651008 4:182270555-182270577 TCAGTTTTTCAGGTTTCTCCAGG + Intronic
984723047 4:182994304-182994326 CCAGATTTTTTGGTTTCTTTTGG - Intergenic
984831141 4:183975270-183975292 CTTCTTTTTCTAGTTTCTTTAGG - Intronic
984962172 4:185108451-185108473 CTAGTTTTTCAGGTTGACTTTGG + Intergenic
985235226 4:187865571-187865593 ATACTTTTTCTGCTTTCTTTAGG - Intergenic
985482959 5:128870-128892 CTCGTTCTTCCAGTTTCTTTGGG - Intergenic
985882089 5:2645974-2645996 TCAGTTTTCAAGGTTTCTTTGGG - Intergenic
986145934 5:5077867-5077889 GTGGTTTTTAAAGTTTCTTTGGG + Intergenic
986248615 5:6033952-6033974 CTAGCTTTTCAGGTTTTCTTTGG + Intergenic
986286314 5:6361682-6361704 GAAGTTTTCCAGGTTTTTTTAGG - Intergenic
986378264 5:7156045-7156067 CTTGTTTTTCTAGTTTCTTTAGG + Intergenic
987144894 5:14982520-14982542 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
987144960 5:14982930-14982952 CTAGTTTTTCGGGTTTCTTTGGG - Intergenic
987265831 5:16254068-16254090 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
987586114 5:19859160-19859182 CTAGTTTTTCAGGTTAACTTTGG - Intronic
987600248 5:20059093-20059115 CTAGATTTTCCAGTTTATTTGGG + Intronic
987908214 5:24106426-24106448 CTAGTGTTTCAGGTTAACTTTGG - Intronic
987965268 5:24864626-24864648 CTAGTGTTTCAGCTTTAGTTTGG + Intergenic
988177618 5:27746974-27746996 CTTGTTTTTCTAGTTTCTTTAGG - Intergenic
988293789 5:29328111-29328133 CAATTTTTACAGGGTTCTTTTGG + Intergenic
988370494 5:30362001-30362023 CTAGATTTTCTAGTTTATTTGGG + Intergenic
988505137 5:31815664-31815686 CCAGTTTCTCAGGTTTACTTTGG + Intronic
988731612 5:33978088-33978110 CTAGGTTTTCAGGTTTCTTTGGG - Intronic
988768858 5:34410860-34410882 CAAGTTTTTCAGGTTAACTTTGG + Intergenic
988866237 5:35338253-35338275 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
988956038 5:36320996-36321018 GTAGTTTTTCATGTGTTTTTTGG + Intergenic
989183366 5:38599866-38599888 CTAGTTTTTCAGGTTAACTTTGG - Intronic
989215002 5:38895179-38895201 CTTGTTTTTCTAGTTTCTCTAGG - Intronic
989320996 5:40133462-40133484 CTAGTATTTTAGGTTAGTTTTGG + Intergenic
989432542 5:41372733-41372755 TCAGTTTTTAAGGTTTCTCTGGG - Intronic
989525637 5:42450931-42450953 ATAGTTTTGAAGGTTTCTTTTGG + Intronic
990067821 5:51739900-51739922 CTAGATTTTCTAGTTTATTTGGG + Intergenic
990123058 5:52479861-52479883 CTAGTTGTTCTGGTTTCTTTGGG - Intergenic
990604209 5:57392175-57392197 CTACTTTTTCTAGTTTCTTAAGG + Intergenic
990614214 5:57490566-57490588 CTAGTTTTTCAGTTTAGCTTTGG + Intergenic
990802403 5:59619654-59619676 GCAGTTTGTCAGTTTTCTTTGGG - Intronic
990883133 5:60562645-60562667 CTGGTTTTTCCATTTTCTTTAGG + Intergenic
991081242 5:62602434-62602456 CTATTTTTTCCCTTTTCTTTTGG + Intronic
991230474 5:64327340-64327362 CTTGCTTTTCTGGTTTCTTGAGG + Intronic
991314305 5:65282822-65282844 CTAGATTTTCAGGTTTACTTTGG + Intronic
991465304 5:66906280-66906302 CTAGTTTTTCAGGTTTACTTTGG + Intronic
991773020 5:70057518-70057540 CTAGTTTTTCAGGTTAATTTTGG - Intronic
991852313 5:70932942-70932964 CTAGTTTTTCAGGTTAATTTTGG - Intronic
992108050 5:73466624-73466646 CTAGGTTTTCAGGTTAATTTTGG + Intergenic
992110490 5:73488081-73488103 CTAGTTTTTCAGGTTTACTTTGG + Intergenic
992164790 5:74038757-74038779 CTTGTTCTTCAGGTTAATTTTGG - Intergenic
992306922 5:75450215-75450237 CTAGTTTTTCAGGTTTAGTTGGG - Intronic
992404043 5:76439154-76439176 ATAGTTTTGAAGGTTACTTTTGG + Intronic
992450405 5:76871029-76871051 TCAGTTGTTCAGGTTTCTCTGGG - Intronic
992542644 5:77779844-77779866 CTAGTTTTTCAGGTTAACTTTGG - Intronic
992583657 5:78209176-78209198 CTAGTTTTTCAGGTTAACTTTGG - Intronic
992802332 5:80304734-80304756 ATAGTTTTTCAGGCCTCCTTTGG + Intergenic
992956098 5:81909937-81909959 CTAGTTTTTCCACTGTCTTTGGG + Intergenic
993230607 5:85230723-85230745 GGAGATTTACAGGTTTCTTTTGG + Intergenic
993250103 5:85510919-85510941 ATGGTTTTGAAGGTTTCTTTTGG + Intergenic
993577221 5:89616985-89617007 TTAGCTTTCCAGCTTTCTTTTGG - Intergenic
993652896 5:90543384-90543406 CTAGTTTTTTAGGTTTACTTTGG + Intronic
993782816 5:92089287-92089309 GCAGTTTTTCATGTGTCTTTTGG + Intergenic
993948334 5:94141845-94141867 ATGGTTTTAAAGGTTTCTTTTGG + Intergenic
994198509 5:96945730-96945752 CTAGTTTTTCATGTTTACTTTGG + Intronic
994233103 5:97331730-97331752 CTAGATTTTCTAGTTTATTTGGG + Intergenic
994327673 5:98467646-98467668 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
994527347 5:100923178-100923200 ATGGTTTTGAAGGTTTCTTTTGG + Intergenic
994829358 5:104759346-104759368 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
994859242 5:105167270-105167292 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
994931300 5:106189191-106189213 TTAATTCTTCAGGTTACTTTAGG + Intergenic
995030678 5:107477549-107477571 CTTATTTTTCAGGTGTCTTTTGG + Intronic
995109817 5:108416790-108416812 CTAGTTTTTTAGGTTAACTTTGG - Intergenic
995454123 5:112333992-112334014 CTAGTTTTTCAGGTTTCACTGGG - Intronic
995477308 5:112561270-112561292 CTAGTTTTTCAGGTTTAGTTGGG - Intergenic
995566497 5:113436381-113436403 CTAGTTTTTCAGATTAATTTTGG - Intronic
995579407 5:113579811-113579833 CTTGTTTTTCAGTTTTCTTGGGG + Intronic
995586771 5:113656219-113656241 TCAGTTTTTCAGGTTTCTTGGGG + Intergenic
995594354 5:113731791-113731813 CAAGTTTTTCAGGTTAATTTTGG + Intergenic
996066697 5:119087222-119087244 CTTGTTTTTCAAGTTCCTTGAGG + Intronic
996223071 5:120956397-120956419 CTATTTCTTCAGGTTTACTTTGG + Intergenic
996236429 5:121136620-121136642 CTAGTTTTTCAAGTTAACTTTGG - Intergenic
996238639 5:121167368-121167390 ATATGTTCTCAGGTTTCTTTAGG - Intergenic
996288703 5:121826721-121826743 ATAGTTTTGAAGGTTCCTTTTGG + Intergenic
996305867 5:122046807-122046829 GCAGTTTTTCATGTGTCTTTTGG + Intronic
996688728 5:126314006-126314028 CTACTTTTTCAGGTTAACTTTGG + Intergenic
997186126 5:131884062-131884084 CTAGACTTTCAAGTTTATTTAGG - Intronic
997258160 5:132445023-132445045 CTAGTTTTTCAGGTTAACTTTGG + Intronic
997805500 5:136913325-136913347 CCATTTTTTCATGTGTCTTTTGG + Intergenic
998032641 5:138884754-138884776 CTAGTTTTTCAAGTTTACTTTGG + Intronic
998218858 5:140258834-140258856 CTAGTTTTTCACATCTCATTTGG - Intronic
998596417 5:143535249-143535271 CTAGTTGTGCACGTTTTTTTGGG + Intergenic
998667449 5:144314572-144314594 CCAGCTTTTCAGGATTTTTTGGG + Intronic
999469774 5:151843611-151843633 CTACTTTTTCAAGATTGTTTTGG - Intronic
999483152 5:151967263-151967285 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
999582016 5:153049381-153049403 CTAGTTTTTAAGTTTTACTTTGG - Intergenic
999801732 5:155044756-155044778 CTAGTTTTTCAAGTTTACTTTGG - Intergenic
999811334 5:155130457-155130479 CAAGTATTTCTGGTTTCTTCTGG - Intergenic
999870212 5:155741992-155742014 GTAGTTTTTCGGGTTTACTTTGG + Intergenic
1000095157 5:157965225-157965247 CTGGATTTTCAGGTTTACTTTGG + Intergenic
1000134529 5:158334114-158334136 CTAGGTTTTCAAGTTTGTGTGGG + Intergenic
1000466974 5:161591444-161591466 CTTGTTTTTCTAGTTCCTTTAGG + Intronic
1000481815 5:161785979-161786001 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1000584658 5:163082258-163082280 ATGGTTTTGAAGGTTTCTTTTGG - Intergenic
1000657112 5:163892920-163892942 CTAGTTTTTCAGGCTAATGTTGG - Intergenic
1000806555 5:165800573-165800595 CTACTTTTTCAGGATTCTTTTGG - Intergenic
1001273465 5:170333038-170333060 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1001282640 5:170398183-170398205 CCAGTTTTTCAGGTTACTTTTGG + Intronic
1002209766 5:177591267-177591289 CTTATTTTTCAGGATTGTTTTGG + Intergenic
1002295794 5:178230520-178230542 CTAATTTTTAAGTTTTTTTTTGG + Intronic
1002676599 5:180919337-180919359 CTAGTCCTTCAGGTTTACTTGGG + Intronic
1002869614 6:1155188-1155210 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1003018485 6:2488573-2488595 TCAGTTTTTAAGGTTTCTTCAGG - Intergenic
1003184495 6:3819355-3819377 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1003304656 6:4915449-4915471 CTAGTTATGTAGGTTTCTTTAGG - Intronic
1003321329 6:5054640-5054662 GTGGTTTTTCAGGTATTTTTTGG - Intergenic
1003455375 6:6276980-6277002 TCAGTTTTTAAGGTTTCTCTGGG - Intronic
1003951137 6:11116889-11116911 CTTCTTTTTCAAGTTTCTTATGG + Intronic
1004041081 6:11976291-11976313 CTATTTTTCCAGGTTTATTATGG - Intergenic
1004068107 6:12270336-12270358 CTTGTTTTTCTAGTTTCTTGAGG + Intergenic
1004123317 6:12847583-12847605 ATAGTTTTTCTGTTTTCTTTGGG - Intronic
1004449149 6:15728704-15728726 AGTGTTTTTCAGGTTTCCTTTGG + Intergenic
1004574812 6:16885547-16885569 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1005279335 6:24255668-24255690 ATACTTTTTCATGTATCTTTTGG - Intronic
1005363279 6:25053017-25053039 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1005593963 6:27360086-27360108 CTAGATTTCCAGATTTCTTCCGG + Intergenic
1005666951 6:28067309-28067331 TTAATTATTCAGGTTTATTTTGG - Intergenic
1005981768 6:30842030-30842052 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
1006209225 6:32379666-32379688 CTTGTTTTTCAAGATTGTTTTGG - Intergenic
1006286499 6:33099312-33099334 ATAGTTTTGAAGGTTTCTTTTGG - Intergenic
1006420865 6:33933092-33933114 CCATTTTTTAAGGTTTCTCTGGG - Intergenic
1006498000 6:34437772-34437794 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
1006579970 6:35071557-35071579 CCTGTTTTTCAGGTTTCTGTGGG + Intronic
1007095639 6:39211022-39211044 TCAGTTTTCCAGGTTTTTTTAGG - Intronic
1007101441 6:39250147-39250169 TCAGTTTTTAAGGTTTCTCTGGG + Intergenic
1007325849 6:41059003-41059025 CTTGGGTTTCAGGTTTCTTTGGG + Intronic
1007872340 6:45054469-45054491 ATAGTTTTTCCAGTTTCTTTAGG + Intronic
1008104102 6:47424459-47424481 CTCAGTTTTAAGGTTTCTTTGGG - Intergenic
1008119503 6:47595979-47596001 CTGGTTTTTCAGGTCGCTTTGGG - Exonic
1008226495 6:48924678-48924700 CCAGTTTTTCAGGTTTTCTCTGG - Intergenic
1008231457 6:48989375-48989397 CATGGTTTTGAGGTTTCTTTTGG - Intergenic
1008263953 6:49400725-49400747 GTAATATTCCAGGTTTCTTTGGG - Intergenic
1008730255 6:54473517-54473539 CCAGTTTTTCAGGTTAGCTTCGG - Intergenic
1008751831 6:54744053-54744075 CTATTTTGTCTGCTTTCTTTTGG + Intergenic
1008775153 6:55029425-55029447 CTTGTTTCTCTGGTTTCTTGAGG + Intergenic
1009166015 6:60341926-60341948 TCAGTTTTTTAGGTTTCTCTGGG + Intergenic
1009346400 6:62617113-62617135 CTAGCTTTTCAGGTTTACTTTGG - Intergenic
1009662674 6:66634199-66634221 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1009737196 6:67691167-67691189 CTAGTTTTTCAAGTTAGCTTTGG - Intergenic
1009915783 6:69994013-69994035 CTTGTTTTTCAAGTTCCTCTAGG + Intronic
1010279124 6:74003478-74003500 GTAGTGTTTCAGAATTCTTTTGG + Intergenic
1010358357 6:74963091-74963113 ATAGTTTTTAGGGTTCCTTTTGG + Intergenic
1010382494 6:75241299-75241321 TTGGTTTTGAAGGTTTCTTTAGG - Intronic
1010563501 6:77380648-77380670 CTTGTTTTTCAAGATTGTTTAGG - Intergenic
1010770464 6:79822638-79822660 CTAGATTTTCAGCTTTGTTTGGG + Intergenic
1010773342 6:79857928-79857950 CTTGTTTTCCTGGTTTCTTCTGG - Intergenic
1011230012 6:85150206-85150228 CTAGTTTTCCAGGTTAATTTTGG - Intergenic
1011267288 6:85535448-85535470 CTAATTTTTGTGGTTTTTTTTGG - Intronic
1011326352 6:86152787-86152809 CTAGGTTCTCAGGTTTCTATAGG + Intergenic
1011400465 6:86955934-86955956 CTAGTTTTTCAGGTTTACTTTGG - Intronic
1011594592 6:89004327-89004349 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1011623140 6:89261434-89261456 TCAGTTTTTAAGGTTTCTCTGGG - Intronic
1012087567 6:94850068-94850090 CTACCTCTTCAGGATTCTTTAGG + Intergenic
1012118147 6:95330972-95330994 CTAGTTTTTCAGGTTATCTTTGG + Intergenic
1012205108 6:96451815-96451837 ACAGCTTTTAAGGTTTCTTTGGG - Intergenic
1012205808 6:96458978-96459000 CTAGTTTTTCAGGTTAGCTTTGG + Intergenic
1012238566 6:96846470-96846492 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
1012315324 6:97778426-97778448 CTAGTTTATCAGGTTTACCTTGG - Intergenic
1012432391 6:99178321-99178343 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1012483316 6:99691903-99691925 ACATTTTTTCAGGTGTCTTTTGG - Intergenic
1012573834 6:100765288-100765310 CTAGTTTTTCAGGTTATCTTTGG - Intronic
1012656432 6:101828359-101828381 CTTGTTTTTCTAGTTCCTTTAGG - Intronic
1013088994 6:106882370-106882392 CTAGTTTTACAGGTTAACTTTGG + Intergenic
1013243613 6:108268263-108268285 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1013419234 6:109951084-109951106 CTAGCTTTTCAGGTTAACTTTGG + Intergenic
1013746586 6:113353238-113353260 ATAGTTTTCCCTGTTTCTTTGGG + Intergenic
1013882829 6:114925961-114925983 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1014061795 6:117080454-117080476 CTATTTTTTCATGTGTCTGTTGG + Intergenic
1014120298 6:117717237-117717259 CTAGGTTTTCAAATTTATTTGGG + Intergenic
1014171977 6:118288737-118288759 CTAGATTTTCAGGTTAACTTTGG + Intronic
1014241827 6:119026531-119026553 CTATTTTTTCAGGTTTCTTTGGG - Intronic
1014242693 6:119035246-119035268 CTAGTTTATCAGGTTAACTTTGG - Intronic
1014252375 6:119127989-119128011 CTAGTGTTTCAGGTTTCTTTGGG - Intronic
1014285284 6:119489997-119490019 ATGGTTTTGCAGGTTCCTTTTGG - Intergenic
1014529275 6:122539945-122539967 CTAGATTTTCTAGTTTATTTGGG + Intronic
1014615081 6:123588451-123588473 CTAGTTTTTCAGGTTTACTTTGG + Intronic
1014786003 6:125620008-125620030 ATACTGTTTCAGGTTTCTTAAGG + Intergenic
1014967767 6:127777312-127777334 CTACTTTTAGAGGTTGCTTTAGG + Intronic
1015078752 6:129196935-129196957 CATGATGTTCAGGTTTCTTTAGG - Intronic
1015127589 6:129771662-129771684 TCAGTTTTCAAGGTTTCTTTGGG - Intergenic
1015141512 6:129939341-129939363 CTGGTTTTACAGGCTTCTTTTGG - Intergenic
1015167113 6:130210690-130210712 TTAGTTTTTCAGGTTAATTTTGG - Intronic
1015288693 6:131512676-131512698 GAAGTTTTTCAGGTTAATTTTGG - Intergenic
1015315697 6:131813786-131813808 TCAGTTTTTGAGGTTTCTCTGGG + Intronic
1015603624 6:134934208-134934230 TCAGTTTTTAAGGTTTCTCTGGG - Intronic
1015824234 6:137294829-137294851 CTAGTTTTTCAGGTTCACTTTGG - Intergenic
1015986621 6:138891025-138891047 CTCATTTTTCAGGTTTACTTTGG - Intronic
1016028548 6:139313851-139313873 TTAGTTTTTCAGGTTTTCTTTGG - Intergenic
1016293786 6:142552198-142552220 CTAGTTTTTCAGGTCTCTTTGGG - Intergenic
1016374113 6:143403040-143403062 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1016494222 6:144641543-144641565 CTAGTTTTTCAGGTTAACTCTGG + Intronic
1016517829 6:144915762-144915784 GTAGTTTTGAAGGTTCCTTTGGG - Intergenic
1016560497 6:145391104-145391126 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
1016837154 6:148489419-148489441 CTAGTTTTTTAAGGTTGTTTTGG + Intronic
1016920705 6:149290195-149290217 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1017063653 6:150508794-150508816 TCAGTTTTTCAGGTTTTTCTGGG - Intergenic
1017745162 6:157440288-157440310 CTATTTTGTCATGTGTCTTTTGG - Intronic
1017837032 6:158187965-158187987 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1018168154 6:161119606-161119628 CTTCTTTTTCAGGTTCATTTTGG + Intergenic
1018307829 6:162476805-162476827 CTAGGTGTTCAGGCTTCTTGTGG - Intronic
1018595693 6:165478367-165478389 CTAGATTTTCAGGTCTACTTTGG - Intronic
1018759381 6:166877982-166878004 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1018991840 6:168679705-168679727 CTAGTTTGTCAGGTTTCTTTGGG - Intergenic
1019203304 6:170337794-170337816 CTAGATTTTCTAGTTTATTTGGG + Intronic
1019269458 7:138961-138983 TCAGCTTTTCAGGTTTCTCTGGG + Intergenic
1019269857 7:140745-140767 TCAGCTTTTCAGGTTTCTCTGGG - Intergenic
1019425344 7:973506-973528 CTAACTTTTAAGGTTTTTTTTGG - Intronic
1019679779 7:2340512-2340534 ATATTTTTACAGGTTCCTTTAGG + Intronic
1019950063 7:4364907-4364929 CTAGTTTTTCCGGTTAACTTTGG - Intergenic
1019952841 7:4387755-4387777 CAAGTTTTTAAAGTTTCTTGGGG - Intergenic
1020046369 7:5043857-5043879 TTAGTTTTTCATGTTTATTTTGG - Intronic
1020291725 7:6727761-6727783 TTAGTTCTTCATGTTTATTTTGG - Intergenic
1020363176 7:7351870-7351892 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1020451028 7:8320564-8320586 TTAGTTTTTAAGGTTTCTGTGGG + Intergenic
1020974548 7:14988728-14988750 CTAGTGTTTCAGGTTAACTTTGG + Intergenic
1021009371 7:15442788-15442810 CTAGGTTCTCAGGTTTTTTTAGG - Intronic
1021383198 7:19994024-19994046 CTACTATTTCAGCTTGCTTTTGG - Intergenic
1021390412 7:20086141-20086163 CTACTTTTTCAGGTTAACTTTGG - Intergenic
1021403338 7:20235829-20235851 CTAGTTGTTCAGGTTTTCTAGGG - Intergenic
1021641753 7:22744420-22744442 CTAGTTTTTCAGGTTTCTTCGGG + Intergenic
1021738637 7:23663360-23663382 ACAGTTTTTCAGGTTAGTTTTGG - Intergenic
1021811991 7:24411469-24411491 CTGGCTTTTCAGTTTACTTTAGG - Intergenic
1021917604 7:25450808-25450830 CCATTTTTTCATGTGTCTTTTGG - Intergenic
1022013995 7:26333024-26333046 CTTCTTTTTCAGGATTGTTTTGG + Intronic
1022091698 7:27111766-27111788 CTGGTTTTTCAGGTTCCTGGAGG - Intronic
1022195238 7:28059185-28059207 TTAATTTACCAGGTTTCTTTTGG + Intronic
1022279055 7:28887619-28887641 CCAGTTTGTCAGTTATCTTTTGG - Intergenic
1022359738 7:29646612-29646634 CTAGTTTTTGTGCTTTCTTTTGG + Intergenic
1022368533 7:29749268-29749290 CTAGTTTTTGTGCTTTCTTTTGG + Intergenic
1022616619 7:31937526-31937548 CTAGTTCTTCAGGTTTCTTTGGG + Intronic
1023206234 7:37752764-37752786 ATGGTTTTTTTGGTTTCTTTTGG + Intronic
1023290431 7:38662964-38662986 CTTGTTTTTCTAGTTCCTTTGGG - Intergenic
1023411571 7:39893655-39893677 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
1023667815 7:42542944-42542966 TAAGTTTTTCATGTTTCTCTGGG + Intergenic
1023731218 7:43194161-43194183 CTGGTTTTTCAGGTTTCTTTGGG + Intronic
1023988513 7:45112667-45112689 TCAGTTTTTAAGGTTTCTCTGGG - Intergenic
1024005097 7:45219571-45219593 CTTTTTTTTCTGGTTTCTATTGG + Intergenic
1024013479 7:45290847-45290869 TCAGTTTTCCAGGTTTCTCTGGG + Intergenic
1024122087 7:46253700-46253722 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1024126211 7:46298315-46298337 CTTGTTTTTCTAGTTTCTTGAGG - Intergenic
1024191613 7:47017242-47017264 CAAGTTTTTCTGGTTACCTTTGG + Intergenic
1024311104 7:47969931-47969953 CTGGTTTTTCTGGTTCTTTTAGG - Intronic
1024318015 7:48039438-48039460 CTAATTTTTCAGGTTTACTTTGG + Intronic
1024388448 7:48780170-48780192 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1024446678 7:49488007-49488029 TCAGATTTTCAGGTTTCTCTAGG + Intergenic
1024460332 7:49653104-49653126 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1024461607 7:49665458-49665480 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1024464527 7:49698131-49698153 CATTTTTTTCATGTTTCTTTTGG - Intergenic
1024718104 7:52103859-52103881 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1024719376 7:52118124-52118146 CAATTTTTTCAGGTTAATTTTGG - Intergenic
1024922134 7:54569367-54569389 CTATTTTTTCCCTTTTCTTTCGG + Exonic
1024928812 7:54647536-54647558 CTAGTTTTTCAGGGTTACTTTGG + Intergenic
1025033602 7:55576608-55576630 CTAGTTTTTTAGGTTTCCTTTGG + Intergenic
1025164559 7:56701462-56701484 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1025271560 7:57524702-57524724 CTACCTTTTCATGTTTCATTTGG - Intergenic
1025705718 7:63860614-63860636 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1026086334 7:67266119-67266141 ATAGATTTTCAGGTTTACTTTGG - Intergenic
1026118883 7:67519241-67519263 CTAGTTTTTCAGATTTTCTTAGG - Intergenic
1026119194 7:67521830-67521852 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1026217503 7:68362748-68362770 TCAGTTTTTCAGATTTCTCTGGG + Intergenic
1026305710 7:69139216-69139238 TTTCTTTTTCAGTTTTCTTTTGG - Intergenic
1026459716 7:70603262-70603284 CAAGTTTCTCAGGATGCTTTTGG + Intronic
1026501277 7:70945208-70945230 CTAGGTTTTCAGGTTTTCTTTGG - Intergenic
1026563035 7:71466237-71466259 CTAGTTTTTCAGGTTTCCTTGGG - Intronic
1026563887 7:71473658-71473680 CCAATGTTTCAGGTTTCTCTGGG + Intronic
1026690810 7:72548710-72548732 CTAGATTTTCAGGTTTACTTTGG + Intergenic
1026726936 7:72877334-72877356 TTAGTTTTCCATGTTTATTTTGG - Intergenic
1027116897 7:75488285-75488307 TTAGTTTTCCATGTTTATTTTGG + Intergenic
1027167418 7:75845188-75845210 CTAGTGTTTCAGGTTAACTTTGG + Intronic
1027274907 7:76547313-76547335 TTAGTTTTCCATGTTTATTTTGG - Intergenic
1027292730 7:76731725-76731747 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1027521495 7:79215068-79215090 CTAGTTTTTCTGCTTTACTTTGG - Intronic
1027536333 7:79406819-79406841 CTTCCTTTTCAGCTTTCTTTGGG - Intronic
1027601611 7:80246998-80247020 CTAGTTTTTCAGGTTAATTTTGG + Intergenic
1027620670 7:80481332-80481354 CTAGTTTTTCAGGTTTACTTTGG - Intronic
1027784067 7:82557146-82557168 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
1027963636 7:84978637-84978659 GTAGTTTTGAAGGTTCCTTTTGG + Intergenic
1028130813 7:87170552-87170574 CTAGTTTTACAGGTATCTCAAGG - Intronic
1028369004 7:90069698-90069720 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1028389446 7:90297316-90297338 CTAGTTTTTCAAGTTTACTTTGG + Intronic
1028689593 7:93636694-93636716 CTAGTTTTTCAGGTTAACTTAGG + Intronic
1028917378 7:96274268-96274290 GTATTTTTTCATGTGTCTTTTGG + Intronic
1029059578 7:97783254-97783276 CCATTTTTTCATGTGTCTTTTGG - Intergenic
1029327414 7:99822231-99822253 TCAGTTTTTCAGGTTCCTCTGGG + Intergenic
1029354512 7:100041914-100041936 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1029500974 7:100929702-100929724 CTAGTTTTGCAGGTTTACTTTGG + Intergenic
1029720604 7:102361776-102361798 TTAGTTTTCCATGTTTATTTTGG - Intergenic
1030185321 7:106755955-106755977 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1030558089 7:111051912-111051934 CTACATTTTCAGATTTCTCTGGG - Intronic
1030606276 7:111642243-111642265 TCAGTTTTTCAGGCTTCTCTGGG - Intergenic
1030783854 7:113636124-113636146 TTAGTTGTTCAGGTTTCTGGGGG - Intergenic
1030825701 7:114155222-114155244 CTAGATGTTCAGGTTTACTTTGG - Intronic
1030912721 7:115272133-115272155 CTTTGTTTTCAGGTTTTTTTTGG + Intergenic
1030985092 7:116231869-116231891 CTAGTTTTTCAGGCTCACTTTGG + Intronic
1030995062 7:116350273-116350295 CTAGTTCTTAAGGATCCTTTGGG - Intronic
1031165074 7:118217958-118217980 CCAGTTTTTAAGGTTTTTCTGGG + Intronic
1031188839 7:118519830-118519852 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1031388405 7:121181986-121182008 CTAGTTTCCCAGGTTCATTTTGG - Intronic
1031478576 7:122251601-122251623 CTAGTTTGGCAGGAGTCTTTGGG - Intergenic
1031787053 7:126046172-126046194 CCATTTATTCAGGTTTGTTTTGG + Intergenic
1032288936 7:130568899-130568921 CTGGTTTTCAAGGTTCCTTTTGG - Intronic
1032444571 7:131971010-131971032 CTCTTTTTTCAGGTATCATTGGG + Intergenic
1032445487 7:131979107-131979129 CAATTTTTTCATGTGTCTTTTGG + Intergenic
1032674251 7:134113818-134113840 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1033162232 7:139007865-139007887 CTGATTTTTCAGGTTTACTTTGG - Intergenic
1033175808 7:139122684-139122706 CTAGTTTTTCAGATTAACTTTGG + Intergenic
1033503044 7:141973049-141973071 CTATTGTTTCTGGTTTCTTCTGG - Exonic
1033577221 7:142697035-142697057 CTGGTTTTTCAGGTTAACTTTGG + Intergenic
1033801300 7:144905555-144905577 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1033927323 7:146479691-146479713 CAAGTTTTTTGGGTTTTTTTTGG - Intronic
1033947473 7:146739193-146739215 TTTGTTTTTCAAGTTTCTTGAGG + Intronic
1033983785 7:147198046-147198068 CAAGTTTTTCATTTGTCTTTAGG - Intronic
1034060148 7:148079877-148079899 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1034205962 7:149315539-149315561 CTTGTTTTTCTAGTTCCTTTAGG + Intergenic
1034223874 7:149467519-149467541 CTAGTTTTTCAGGTTAGCTTTGG + Intergenic
1034408889 7:150926601-150926623 CAATTTTTTTAGCTTTCTTTTGG - Intergenic
1034619180 7:152444238-152444260 CTTGTGTATCAGGTTTCTTAGGG - Intergenic
1034681644 7:152933389-152933411 TTAGTTTTTCAGGTTAACTTTGG - Intergenic
1035013693 7:155744113-155744135 CTAATTCTTAAGGTTTATTTAGG + Intronic
1035075090 7:156172287-156172309 CTAGTTTTTCAGGTCTCCTGAGG + Intergenic
1035183310 7:157106584-157106606 CTAGCGTTTCAGGTTTACTTTGG + Intergenic
1035476489 7:159147855-159147877 CTCGTTTTTCAGGTTTCTTTGGG - Intergenic
1035632249 8:1116985-1117007 TTTATTTTTCAGCTTTCTTTTGG - Intergenic
1035645929 8:1220168-1220190 CTTGGTTTTCTAGTTTCTTTAGG + Intergenic
1035952055 8:4032851-4032873 CTAGTTTTTCAGATTAACTTTGG - Intronic
1036057906 8:5280309-5280331 CTAGTTTCTTAGGTTTCTTTTGG - Intergenic
1036636644 8:10555188-10555210 CTAGTGTTTCAGGTTAACTTTGG - Intergenic
1036705572 8:11043705-11043727 TTAGTTTTTAAGATTTCTCTGGG - Intronic
1037120115 8:15273974-15273996 CTATTCTTTCAGGTTTGTTAAGG - Intergenic
1037138269 8:15489794-15489816 ATAGTTTTTCAGGTTTACTTTGG + Intronic
1037173945 8:15925243-15925265 TCAGTTTTCCAGGTTTGTTTGGG + Intergenic
1037204008 8:16292395-16292417 CTAGTTTTTGAAATTGCTTTTGG + Intronic
1037209696 8:16371516-16371538 CTAGTTTTTCAGGTTTTCTTTGG + Intronic
1037288376 8:17324805-17324827 CTAGATTTTCAGGTTATTATTGG + Intronic
1037305573 8:17499693-17499715 TAAGTTTTTCAGGATTCATTTGG - Intronic
1037331665 8:17749059-17749081 CTAGTTTTTCAGGTTAACCTTGG - Intronic
1037379858 8:18274009-18274031 TCAGTTTTTCAGGTTTCTCTGGG - Intergenic
1037387641 8:18360476-18360498 TTAGCTTTTCAGGTTTATCTGGG - Intergenic
1037390976 8:18391458-18391480 TTAGTTTTCCAGGTTTCTCTGGG - Intronic
1037413154 8:18619172-18619194 TCAGTTTTTTAGGTTTCTTTTGG - Intronic
1037554626 8:20010193-20010215 CTAGTTTTTTAGGTTAACTTTGG + Intergenic
1037598839 8:20376578-20376600 CTAGTTTTTCAGGTTTATTGGGG - Intergenic
1038040836 8:23722716-23722738 GTAGTTTTGCAAGTTTCCTTGGG + Intergenic
1038458144 8:27692011-27692033 CTGGTTTTTCAGGTTAATTTTGG - Intergenic
1038469312 8:27799195-27799217 TTAGTGTTACTGGTTTCTTTAGG + Intronic
1038506761 8:28091362-28091384 CTAGTTTTTCAGTTTAACTTTGG + Intronic
1038739518 8:30204647-30204669 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1038905451 8:31897187-31897209 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1038919242 8:32064355-32064377 CTGAGTTTTCAGGTTTCATTTGG + Intronic
1038919392 8:32065946-32065968 GCATTTTTTCATGTTTCTTTTGG + Intronic
1039058868 8:33557784-33557806 ACAGTTTTTTAGGTTTGTTTTGG + Intronic
1039264214 8:35807338-35807360 CTAATTTTTCAGGTTAACTTTGG + Intergenic
1039501411 8:38020597-38020619 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1039501926 8:38024716-38024738 CTAGTTTTTCAGGTTAACATTGG - Intergenic
1039655063 8:39395301-39395323 GCAGTTTTTCATGTGTCTTTTGG - Intergenic
1039667096 8:39545204-39545226 CTTGTTTCTCAAGTTTCTCTGGG + Intergenic
1039685293 8:39795259-39795281 CTTGTTTTTCAGATTAATTTTGG - Intronic
1039722192 8:40176174-40176196 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
1039736496 8:40338255-40338277 CTAATTTTTCAGGCTTCTTTGGG + Intergenic
1039799472 8:40941785-40941807 CTAGTTTTTTAGGTTTCTTTGGG + Intergenic
1039829186 8:41199536-41199558 CTAGTTTTTCAGGGCTCTTCTGG - Intergenic
1039846072 8:41326469-41326491 CTAATTTTTAAGGTTTTTGTAGG + Intergenic
1040055677 8:43055488-43055510 CAAGTTTTTCAGGTTAACTTTGG + Intronic
1040587956 8:48762338-48762360 CTGGTTTTTCATTTTTTTTTGGG + Intergenic
1040773781 8:51013900-51013922 CTCGTTTTTCTAGTTGCTTTAGG + Intergenic
1041025764 8:53684826-53684848 TTATTTTTTCAAGGTTCTTTTGG - Intergenic
1041033328 8:53760734-53760756 TCAGTTTTTGAGGTTTCTCTGGG - Intronic
1041126706 8:54648267-54648289 TAATTTTGTCAGGTTTCTTTGGG - Intergenic
1041242035 8:55856386-55856408 TTAGTTTTTCAAGATTCTCTAGG - Intergenic
1041271171 8:56110919-56110941 CTAATTTTGCAGGTCTCTCTGGG + Intergenic
1041650650 8:60299001-60299023 CTAGGTTTTATGGCTTCTTTTGG - Intergenic
1041720340 8:60969572-60969594 TCAGTTTTTAAGGTTTCTCTGGG + Intergenic
1041951249 8:63505511-63505533 CTATTTTTTCATGTGTCTGTTGG + Intergenic
1041953863 8:63536103-63536125 TTAGCTTTTCTGGATTCTTTAGG + Intergenic
1042068596 8:64905622-64905644 TCTGTTTTTCAGGTTTCTCTGGG + Intergenic
1042184437 8:66122670-66122692 CTAGTTTTTTAGGTTTACTTTGG - Intergenic
1042198221 8:66252615-66252637 CTAGATTTTCAGGGGTCGTTGGG + Intergenic
1042364842 8:67924257-67924279 ATTGTTTTTCAGGATTCTGTGGG + Intergenic
1042933475 8:74035543-74035565 CCAGTTTTTCAGGTTATCTTTGG - Intergenic
1042936558 8:74065027-74065049 TCAGTTTTTCAGGTTTCGCTTGG - Intergenic
1043104162 8:76087087-76087109 CTTGTTTTTCTAGTTTCTTGAGG + Intergenic
1043239640 8:77916675-77916697 GTATTTTTTCATGTGTCTTTTGG + Intergenic
1043315284 8:78913565-78913587 ATAGTTTTGCAATTTTCTTTGGG - Intergenic
1043413114 8:80020358-80020380 CTAGTTTTTCAGGTTAACTTTGG + Intronic
1043416886 8:80060384-80060406 CTACTTTTACACTTTTCTTTGGG - Intronic
1043535730 8:81202179-81202201 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1043624041 8:82232573-82232595 CTAGTTTTTCAGGTTAATGTTGG - Intergenic
1043803321 8:84639519-84639541 CTGGTTTTTTAGGTTTCTTTGGG + Intronic
1043924535 8:86022014-86022036 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1043946151 8:86255112-86255134 TTAGTTTTTCAGGATTCTTTGGG - Intronic
1043947924 8:86275251-86275273 CCAGTTTTTCAGGTTAACTTTGG + Intronic
1043948660 8:86282951-86282973 CCAGTTTTTCAGGTTAACTTTGG + Intronic
1044042791 8:87390471-87390493 GCATTTTTTCATGTTTCTTTTGG - Intronic
1044111062 8:88274857-88274879 TTTCTTTTTCAGGTTTGTTTAGG - Intronic
1044118922 8:88369223-88369245 CTTGTTTTTCTAGTTTCTTTAGG + Intergenic
1044188180 8:89281556-89281578 CTAGTTTTTCAGGTTTCCTCTGG - Intergenic
1044274171 8:90280873-90280895 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1044396585 8:91720474-91720496 CTAGTTTTTCAGGTTTTCTTTGG + Intergenic
1044522629 8:93216969-93216991 CTAGTGTTTCAGGTTTATTTTGG + Intergenic
1044566243 8:93663576-93663598 CTAGTTTTTCAAGTTAACTTTGG - Intergenic
1044723815 8:95175962-95175984 CTAGTTTTTCAGGTTAGCTTTGG - Intergenic
1044768256 8:95600471-95600493 CTTGTTTTTCTAGTTTCTCTAGG - Intergenic
1044774260 8:95671291-95671313 CTTGTTTTTAAGCTTTCTTAAGG - Intergenic
1044891816 8:96844215-96844237 AAAGTTTCTCAGGATTCTTTTGG - Intronic
1044955836 8:97479039-97479061 CTTGTTTTTCTAGTTTCTCTAGG - Intergenic
1044983601 8:97739440-97739462 CTATTTTTCTAGGTTTGTTTTGG + Intergenic
1045043994 8:98257084-98257106 TTAGTTTTTCAGGTTAACTTTGG - Intronic
1045099773 8:98832661-98832683 TTAGTTTTTAAGGTTTCTCTGGG + Intronic
1045126039 8:99090072-99090094 GTAGTTTTTCAGGTTAAGTTTGG + Intronic
1045150288 8:99398909-99398931 CCAGTTTTTCAGGTTAACTTTGG + Intronic
1045156870 8:99486222-99486244 TTAGTTTCTCATGTTTGTTTTGG + Intronic
1045222136 8:100209471-100209493 CTATTTTTTCAGGATCTTTTTGG + Intronic
1045253085 8:100497488-100497510 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1045533532 8:103006152-103006174 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1045612655 8:103864234-103864256 CTTGTTTCTCAGGTTGCTTCAGG + Intronic
1045785978 8:105920894-105920916 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
1046147833 8:110185093-110185115 CTTGATTTTCTGGTTTCTTAAGG + Intergenic
1046394155 8:113618005-113618027 CATGTCTTTCAGGTGTCTTTTGG - Intergenic
1046405254 8:113764387-113764409 CTTGTTTTTTTGTTTTCTTTTGG + Intergenic
1046451612 8:114399198-114399220 CTTGTTTTTCTAGTTTCTCTAGG + Intergenic
1046867691 8:119169360-119169382 CTAGTTTTTCATGTTACCTCGGG + Intronic
1047357072 8:124132426-124132448 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
1047399467 8:124533718-124533740 TTAGTTTTTCATGTTTTTCTGGG + Intronic
1047530881 8:125674164-125674186 CTGGTTTTGAAGGTTCCTTTTGG + Intergenic
1047544827 8:125805336-125805358 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1048370074 8:133769421-133769443 CTAGATTTTCGGGTTTATTTTGG - Intergenic
1048452356 8:134544608-134544630 CTATTTTTTCATTTTTCTGTTGG - Intronic
1048621347 8:136136155-136136177 CTAGTTTATCAGGTTTGCATTGG - Intergenic
1048621450 8:136137338-136137360 CTTGTTTTTCAGGTTAACTTTGG - Intergenic
1048655760 8:136534123-136534145 CTAGTTTTTCAGGTTAACTTAGG - Intergenic
1049069920 8:140348582-140348604 CTTGCTTTTCAGGTTGTTTTTGG - Intronic
1049454424 8:142679911-142679933 CCAGTTTTTCAGGTTAACTTCGG + Intronic
1049467576 8:142759059-142759081 CCAGTTTTTCAGGTTCACTTTGG - Intergenic
1049811725 8:144578065-144578087 CTAATTTTTCAAGGTTGTTTTGG - Intronic
1049860766 8:144897020-144897042 CTGGCTTTCCAGTTTTCTTTAGG + Intronic
1049870195 8:144968926-144968948 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1049926435 9:412949-412971 CTTGTTTTTCAAGGTTGTTTTGG - Intronic
1049959837 9:727918-727940 CTAGTTTTTCAGGTTTACTATGG - Intronic
1050000147 9:1068924-1068946 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1050247899 9:3710600-3710622 CTTCTTTTTCTGGCTTCTTTTGG - Intergenic
1050352820 9:4756467-4756489 TCAGTTTTTCAGATTTCTCTTGG + Intergenic
1050401906 9:5265328-5265350 ATTGGTTTTCAGATTTCTTTTGG + Intergenic
1050464315 9:5905284-5905306 TCAGTTTTTCAGGTTTCCCTGGG - Intronic
1050489759 9:6176117-6176139 CTAGTTTTTTAGTTTTTTTGTGG - Intergenic
1050771373 9:9205526-9205548 TTTGTTTTTCAAGTTTCTATGGG - Intronic
1050796859 9:9557188-9557210 CTAGTTTTTCAAGTTTAATTTGG - Intronic
1050878501 9:10671387-10671409 CTTGTTTCTCTGGTTCCTTTAGG + Intergenic
1050952485 9:11615696-11615718 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1051036717 9:12756102-12756124 CTAGGTTTTCATTTTTTTTTTGG + Intergenic
1051427568 9:16948913-16948935 CTTGTTTTTCAAGATTGTTTTGG + Intergenic
1051427597 9:16949512-16949534 CTTGTTTTTCAAGATTGTTTTGG - Intergenic
1051738755 9:20230494-20230516 CCATTTTTTCATGTGTCTTTTGG + Intergenic
1051875821 9:21792188-21792210 ATAGTTTTTCATGTATCTGTTGG - Intergenic
1051897556 9:22004734-22004756 CTACTTTTTCAGCAATCTTTTGG + Exonic
1052007633 9:23368168-23368190 GAAGTTTTCTAGGTTTCTTTTGG - Intergenic
1052117189 9:24663592-24663614 GCAGTTTTTCATGTGTCTTTTGG + Intergenic
1052171038 9:25396871-25396893 CTAGTTTTTCAGGCTAACTTTGG - Intergenic
1052223864 9:26060423-26060445 CTAGTTTTTCAGTTTTTTGGAGG + Intergenic
1052307467 9:27026661-27026683 ATGGTTTTTAAGGTTCCTTTTGG - Intronic
1052516555 9:29488428-29488450 TTAGTGTTTCAGTTTTCATTAGG + Intergenic
1052541326 9:29815693-29815715 CTTCTTTTTCAGGTTTTTTCTGG - Intergenic
1052596699 9:30570684-30570706 CTAGATTTTCTGTTTTATTTAGG - Intergenic
1053082241 9:35186014-35186036 GTAGTTTTTCAGGTTTCTTTGGG - Intronic
1053086610 9:35229264-35229286 CCAGTTTTTCAGGTTTTCCTGGG - Intronic
1053393648 9:37753433-37753455 CTAGTTTTTAAGGTTTCCTTCGG + Intronic
1053539398 9:38958221-38958243 CTAGCTTTTTAGGTTTCTTTGGG - Intergenic
1053626001 9:39872102-39872124 CTATTTTTTGAGGTTTATTTGGG - Intergenic
1054217887 9:62378599-62378621 CTATTTTTTGAGGTTTATTTGGG + Intergenic
1054263455 9:62895608-62895630 CTATTTTTTGAGGTTTATTTGGG - Intergenic
1054626743 9:67405697-67405719 CTAGCTTTTCAGGTTTCTTTGGG + Intergenic
1055013782 9:71594357-71594379 CTAGATTTTCAGGTTTATTTTGG - Intergenic
1055108737 9:72538963-72538985 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1055130739 9:72771282-72771304 ATAGTTTTTCAGATCTCTGTTGG + Intronic
1055186903 9:73468038-73468060 CTTGTTTCTCTGGTTTCTTGAGG + Intergenic
1055207349 9:73748736-73748758 CTTTTTTTTCTAGTTTCTTTAGG + Intergenic
1055214470 9:73841429-73841451 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1055233598 9:74091720-74091742 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1055644893 9:78353935-78353957 TTGGTTATTCAGGGTTCTTTGGG + Intergenic
1055649615 9:78394489-78394511 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1055745735 9:79442197-79442219 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1056521573 9:87406893-87406915 CTAGTTTTTCAGGTTGACTTTGG - Intergenic
1056619112 9:88195703-88195725 CTTGTTTTTTAGGTGTCCTTTGG - Intergenic
1056701569 9:88915592-88915614 CTAGTATTTCAGGTTTATTATGG + Intergenic
1056715578 9:89025556-89025578 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1056723024 9:89087738-89087760 CTAGTTTTTCACGTTTACTTTGG - Intronic
1056739638 9:89243286-89243308 TTAGTTTTTCAGGTTTCCCTTGG + Intergenic
1056891795 9:90501307-90501329 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
1056911287 9:90703156-90703178 TCAGTTTTTGAGGTTTCTCTGGG + Intergenic
1056983971 9:91343975-91343997 CTAGTTTCTCAGGTTAGCTTTGG - Intronic
1056995333 9:91452049-91452071 CTAGTTTTCCAGGTTAACTTTGG - Intergenic
1057001418 9:91513233-91513255 CTAGATCCTCTGGTTTCTTTAGG - Intergenic
1057097832 9:92328051-92328073 TGAGTTTTTAAGGTTTCTTTGGG + Intronic
1057478257 9:95423636-95423658 TTAATTTTTAAGGTTTCTTTTGG - Intergenic
1057580130 9:96280188-96280210 CTGGTTTTTCAGGTTAACTTAGG + Intronic
1057628298 9:96698623-96698645 CTTGTTTTTCATGGTTGTTTTGG - Intergenic
1057779632 9:98039059-98039081 TTAGTGTCTCAGGTTTTTTTTGG - Intergenic
1057981561 9:99669128-99669150 CTAGCTTTTCAGGTTTCTTTGGG + Intergenic
1058161959 9:101579649-101579671 TCAGTTTTTAAGGTTTCTTCGGG - Intronic
1058301069 9:103373646-103373668 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1058308618 9:103473153-103473175 TTAGTTTTTAAGGTTTTTCTTGG - Intergenic
1058716618 9:107728014-107728036 CAAGTTTTTCATGTTACCTTAGG - Intergenic
1058784927 9:108377624-108377646 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
1058910044 9:109512700-109512722 GTAATTATTCAGGGTTCTTTAGG + Intergenic
1058980274 9:110162442-110162464 TTGGTTTTTAAAGTTTCTTTAGG + Intronic
1059214417 9:112547455-112547477 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1059623883 9:116040007-116040029 CCAGTTTTCCTGGTTTGTTTGGG - Intergenic
1059738990 9:117131205-117131227 TCAGCTTTTCAGGTTTCTCTTGG - Intronic
1059795457 9:117690869-117690891 CTTCTTTTTCAGGTTGTTTTGGG - Intergenic
1060057447 9:120426985-120427007 CTAGTTTTTAAGGTTTTGTTGGG + Intronic
1060093483 9:120765635-120765657 CTTGGCTTTCAGGTTTCTTCTGG - Intronic
1060163290 9:121386999-121387021 CTGGTTTTTCAGGTTAATTCTGG + Intergenic
1060330732 9:122666883-122666905 CTTGCTTTTCATGTTTCTTGTGG - Intergenic
1060386615 9:123235532-123235554 TTAGATTTTCAGTTGTCTTTGGG - Intronic
1061015644 9:127979767-127979789 CTAGTCTTTCAGCCTTCTCTTGG - Intronic
1061966755 9:134018987-134019009 GCTGTTTTTCAGGTTTCTCTGGG + Intergenic
1062259315 9:135652117-135652139 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1203690756 Un_GL000214v1:40262-40284 GTATTTTTTCATGTGTCTTTTGG + Intergenic
1203369921 Un_KI270442v1:293526-293548 CTAGCTTTTCAGGTTAACTTTGG - Intergenic
1203645539 Un_KI270751v1:63929-63951 GTATTTTTTCATGTGTCTTTTGG - Intergenic
1185435954 X:95234-95256 GTTGTTTTTCAGGTTTCTTTGGG + Intergenic
1185444304 X:249788-249810 GTTGTTTTTCAGGTTTCTTTGGG - Intergenic
1185503348 X:615394-615416 CTAGTTTTTCTGGTGTCTTTGGG - Intergenic
1185503410 X:615771-615793 CTAGTTTCTATGGTGTCTTTGGG - Intergenic
1185503479 X:616192-616214 CTAGTTTTTCTGATGTCTTTGGG - Intergenic
1185503545 X:616571-616593 CTTGTTTCTCTGGTGTCTTTGGG - Intergenic
1185696163 X:2196321-2196343 CTAGTTTTTCAGCTTAACTTTGG - Intergenic
1185779928 X:2835387-2835409 CTCGTTTTTCAGGTTAACTTTGG + Intronic
1185788541 X:2911063-2911085 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1185839597 X:3376301-3376323 CCAGTTTTTCAGGTTAACTTTGG - Intergenic
1185971628 X:4671522-4671544 CCAGTTTTTCAGGTTTCTCTGGG - Intergenic
1185975916 X:4719844-4719866 CTAGTTTTTCAGATTATTTGTGG - Intergenic
1185990649 X:4891273-4891295 CTAGTTCTTCAGGTTAATTTTGG + Intergenic
1185991615 X:4897672-4897694 CTAGTTCTTCAGGTTAATTTTGG + Intergenic
1186034204 X:5403233-5403255 TTAGTTTTTCAGGTTTCTCTGGG + Intergenic
1186057511 X:5665627-5665649 TCAGCTTTTCAGGTTTCTCTTGG - Intergenic
1186140703 X:6569291-6569313 CTATTTTTTCTGCTTTCGTTGGG + Intergenic
1186148112 X:6645963-6645985 TCAGTTTTTCAGGATTCTCTGGG + Intergenic
1186162528 X:6792707-6792729 ACAGTTTTTCCTGTTTCTTTGGG + Intergenic
1186175964 X:6926086-6926108 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1186176365 X:6929667-6929689 CTAGTTTTTCAGGTTAACTTCGG + Intergenic
1186328523 X:8507230-8507252 CTAGTTTTCCAGGTAAATTTTGG + Intergenic
1186340786 X:8644275-8644297 CTAATTTTTCAGGTTTATTTGGG - Intronic
1186718314 X:12276707-12276729 GTAGTTTTTCAGGTTAAGTTTGG + Intronic
1186811908 X:13198603-13198625 CTAGTTTTTCAGGTTTACTTTGG - Intergenic
1186830040 X:13381019-13381041 CTAGTTTTTCAGGTTAACTCTGG + Intergenic
1186878310 X:13838927-13838949 CTAGTTTTTCAGATTTACTTTGG - Intronic
1187013089 X:15299660-15299682 CCAGTTTTTCAGGTTAGTTTTGG + Intronic
1187057440 X:15754149-15754171 CTAGTTCTTCAGGTTTCTTTGGG + Intronic
1187101555 X:16198063-16198085 TCAGCTTTTCAGGTTTCTCTGGG - Intergenic
1187141488 X:16598435-16598457 CTAGATTTTCTAGTTTATTTGGG - Intronic
1187349252 X:18496920-18496942 TCAGTTTTTCAGGTTTCTCTGGG + Intronic
1187451869 X:19404539-19404561 CTTGTTTTTCAAGATTGTTTTGG - Intronic
1188058401 X:25568833-25568855 CTAGTTTCTCTGGTTCCTTGAGG + Intergenic
1188366125 X:29317001-29317023 TCAGTTTTTAAGGTTTCTCTGGG + Intronic
1188508133 X:30905700-30905722 TTAGATTTTCAGGTTTACTTTGG - Intronic
1188521511 X:31043284-31043306 CTAGATTTTCAGGTTTACTTTGG + Intergenic
1188631723 X:32371225-32371247 CGTGTTTTTCACGTTTATTTTGG - Intronic
1188830095 X:34886010-34886032 ATAGTTTTTCATGAGTCTTTTGG - Intergenic
1188876221 X:35433622-35433644 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1188877029 X:35442636-35442658 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1188937819 X:36198810-36198832 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1189176219 X:38959965-38959987 CTAGTTTTTCAGGTAAACTTTGG + Intergenic
1189634548 X:42992180-42992202 TCAGTTTTTAAGGTTTCTTTGGG - Intergenic
1189639087 X:43048328-43048350 ATAGTTTTGAAGGTTCCTTTTGG + Intergenic
1189748294 X:44192945-44192967 CTAGTTTTTCAGGTTAACTTTGG - Intronic
1189758738 X:44299218-44299240 CTAGTTTTTCAGGCTAACTTGGG - Intronic
1189854495 X:45210026-45210048 ATAGCATTTCAGGTTTATTTAGG + Intergenic
1189957418 X:46289365-46289387 CTAGTTTTTGAGGTTTCTTTGGG + Intergenic
1190360301 X:49643084-49643106 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1190408232 X:50109123-50109145 GTAGTTTTTCAGGTTAATTTTGG - Intergenic
1190538689 X:51455695-51455717 TTAGTTTTTCAGGTTGCTCTGGG + Intergenic
1190548316 X:51553135-51553157 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1190599464 X:52074954-52074976 CTTGTTTTTCTGGTTCCTCTAGG + Intergenic
1190602076 X:52103339-52103361 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1190609360 X:52179119-52179141 CTTGTTTTTCTGGTTCCTCTAGG - Intergenic
1190866934 X:54392597-54392619 CTAGTTTTTCAGGTTAACTTAGG - Intergenic
1190930150 X:54941623-54941645 GCAGTTTTTCATGTGTCTTTTGG - Intronic
1191165360 X:57384555-57384577 GTATTTTTTCATGTGTCTTTTGG - Intronic
1191232992 X:58111468-58111490 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1191757027 X:64604209-64604231 CTAGATTTTCTAGTTTCTTTGGG + Intergenic
1191903344 X:66061977-66061999 ATAGTTTTGAAGGTTCCTTTTGG + Intergenic
1191907661 X:66110855-66110877 CTATTTTGTGAGGTTTCTTGTGG - Intergenic
1192040863 X:67620021-67620043 CTAGTTCTTGTAGTTTCTTTGGG + Intronic
1192064495 X:67866588-67866610 TTAGTCTTTCAGGAGTCTTTTGG + Intergenic
1192064566 X:67867747-67867769 CTTGTTTTTCCAGTTGCTTTAGG + Intergenic
1192523435 X:71822055-71822077 GCATTTTTTCATGTTTCTTTTGG - Intergenic
1192615492 X:72617082-72617104 CTTGTTTTTCTAGTTACTTTAGG - Intronic
1192675909 X:73196609-73196631 CTAGCTTTTCAGGCTTTTTGGGG - Intergenic
1192680922 X:73253334-73253356 CTGTATTTTCAGGTTTCTTTGGG + Intergenic
1192691005 X:73364235-73364257 CTTGTTTTTCTGGTTCCTTGAGG + Intergenic
1192708693 X:73556766-73556788 TCAGTTTTTCAGGTTTCTCTGGG + Intergenic
1192864371 X:75115733-75115755 CTAGACTTCCAGGTTTCTTTGGG - Intronic
1192878365 X:75256202-75256224 ATAGTTTTGAAGGTTACTTTTGG - Intergenic
1192893831 X:75419330-75419352 CCATTTTTTCATGTGTCTTTTGG - Intronic
1192901011 X:75496694-75496716 ATAGTTTTGAAGGTTCCTTTTGG - Intronic
1192901023 X:75496925-75496947 CTTGTTTCTCATGTTTCTTGAGG - Intronic
1192913413 X:75629677-75629699 CTGGTTTTGAAGGTTCCTTTTGG + Intergenic
1192944815 X:75954734-75954756 CTGGTTTTCAGGGTTTCTTTTGG + Intergenic
1193044700 X:77039972-77039994 GCAGTTTTTCATGTGTCTTTTGG - Intergenic
1193050312 X:77092632-77092654 CTAGATTTTCTAGTTTATTTGGG - Intergenic
1193182538 X:78475149-78475171 ATGGTTTTGAAGGTTTCTTTTGG + Intergenic
1193253145 X:79316833-79316855 CTTGTTTTTCTAGTTCCTTTGGG + Intergenic
1193302597 X:79908286-79908308 CTAGATTTTCAGGTTAACTTTGG - Intergenic
1193383873 X:80848072-80848094 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1193384699 X:80856524-80856546 CCAGTTTATCAGGTTAATTTTGG + Intergenic
1193416274 X:81228626-81228648 CTAGATTTTCAGGTTAACTTTGG + Intronic
1193441724 X:81548951-81548973 CTAGTTTTTCAGATTAACTTTGG - Intergenic
1193454661 X:81716014-81716036 CTAGCTTTTTTGTTTTCTTTAGG + Intergenic
1193585767 X:83319202-83319224 TTAGTTTTTCAGGCTTCTAGGGG + Intergenic
1193850799 X:86535426-86535448 ATAGTTTTTCAGATTTCCTTGGG - Intronic
1193961294 X:87927854-87927876 CTTGTTTCTCTAGTTTCTTTGGG - Intergenic
1193997756 X:88387533-88387555 CTTGTTTTTCTAGTTCCTTTAGG - Intergenic
1194045713 X:88999295-88999317 CTAGTTTTTTAGGTTAATTCAGG + Intergenic
1194047207 X:89023379-89023401 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1194083788 X:89500775-89500797 CCACATTTTCAGGTATCTTTTGG + Intergenic
1194092264 X:89592538-89592560 CTGGTTTTTCAGGTTGACTTTGG - Intergenic
1194129748 X:90066777-90066799 TTAGTTTTTCAGATTTCTTTGGG + Intergenic
1194177742 X:90672696-90672718 CTTGTTTTTCTGGTTTCTTCAGG - Intergenic
1194232404 X:91340567-91340589 CTAGTTTTTTAGGTGTTTGTTGG - Intergenic
1194262243 X:91710589-91710611 CTAGTTTTTCAGGCTAACTTTGG + Intergenic
1194266829 X:91764533-91764555 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1194483076 X:94451129-94451151 GTAGTTTTTCAGGATTCTTTGGG + Intergenic
1194647296 X:96473058-96473080 ATAATTTATTAGGTTTCTTTTGG + Intergenic
1194816025 X:98442474-98442496 ATAGTTTTGAGGGTTTCTTTTGG - Intergenic
1194824146 X:98541031-98541053 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1194934740 X:99935371-99935393 ATAGTTTTGAGGGTTTCTTTTGG + Intergenic
1195237349 X:102914028-102914050 ATGGTTTTTAAGGTTCCTTTTGG - Intergenic
1195368241 X:104147681-104147703 GCAGTTTTTCATGTGTCTTTTGG - Intronic
1195463484 X:105154251-105154273 TTAGTTTTTCAGGTTTCTTTGGG + Intronic
1195565696 X:106336729-106336751 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1195686762 X:107594482-107594504 CTTGTTTTTCTGGTTTCTTAAGG + Intronic
1195759213 X:108227834-108227856 CTAGTTTTCCAGGTTAGCTTTGG + Intronic
1195798879 X:108684480-108684502 CTAGATTTTCTAGTTTATTTGGG - Intronic
1195818266 X:108912367-108912389 ATAGTTTTGGAGATTTCTTTTGG - Intergenic
1195832581 X:109075564-109075586 CTAGATTTTCTAGTTTGTTTGGG + Intergenic
1195970682 X:110469862-110469884 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1196076207 X:111579185-111579207 CTTGTTTTACAGGTTATTTTAGG - Intergenic
1196257630 X:113540211-113540233 TCAGTTTTTCAAGTTTCTCTGGG + Intergenic
1196524617 X:116717841-116717863 TTGGTTTTTCAGGCTTTTTTTGG - Intergenic
1196763136 X:119218187-119218209 CTAGTTTTTCAAGTTGGCTTTGG + Intergenic
1196934563 X:120716738-120716760 CTACCATTTCAGGTTTTTTTTGG + Intergenic
1197132688 X:123022831-123022853 ATGGTTTTGCAGGTTCCTTTTGG - Intergenic
1197149101 X:123200783-123200805 TTAGTTTTTCTGGTCTTTTTTGG + Intronic
1197194962 X:123690387-123690409 ATAGTTTTTCAGCTTTATTCAGG - Intronic
1197351382 X:125387618-125387640 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1197664380 X:129208012-129208034 ATGGTTTTAAAGGTTTCTTTTGG + Intergenic
1198276880 X:135103093-135103115 TTAGTTTTTCAGGTTAACTTTGG + Intergenic
1198450849 X:136766372-136766394 CTATTTTGTGAGGTTTTTTTTGG + Intronic
1198981668 X:142404652-142404674 CTAGATTTTCTAGTTTATTTCGG - Intergenic
1199170534 X:144729886-144729908 GTAGTTTTTCAGGTTCCTTTTGG - Intergenic
1199243029 X:145570342-145570364 CTGGCCTTTAAGGTTTCTTTTGG - Intergenic
1199372742 X:147070348-147070370 AGAGTTTTTCAGGGTTCTCTCGG - Intergenic
1199651742 X:149951820-149951842 CTAGTTTTTCAGGTTAACTTTGG + Intergenic
1200425441 Y:3015476-3015498 CTAGTTTTTCAGGTTATCTTTGG + Intergenic
1200436437 Y:3156657-3156679 CCACATTTTCAGGTATCTTTTGG + Intergenic
1200444895 Y:3248575-3248597 CTGGTTTTTCAGGTTGACTTTGG - Intergenic
1200495789 Y:3881533-3881555 CTAGTTTCTCAGGTTAACTTTGG + Intergenic
1200496596 Y:3892782-3892804 CTAGTTTTTCTCGTTAATTTTGG - Intergenic
1200524412 Y:4254845-4254867 CTTGTTTTTCTGGTTTCTTCAGG - Intergenic
1200581537 Y:4955422-4955444 CTAGTTTTTCAGGCTAACTTTGG + Intergenic
1200584029 Y:4985445-4985467 CTAGTTTTTCAGGTTAACTTTGG - Intergenic
1200914254 Y:8557454-8557476 TGTGTTTTTCAGGGTTCTTTGGG - Intergenic
1200927332 Y:8666251-8666273 TGTGTTTTTCAGGATTCTTTGGG - Intergenic
1200928665 Y:8677227-8677249 TGAGTTTTTCAGGGCTCTTTGGG + Intergenic
1200944037 Y:8814402-8814424 CCAGTTTTTCAGTTTTTTTCTGG - Intergenic
1201068387 Y:10121540-10121562 CTAGCTTTTCAGGTTAATTTTGG + Intergenic
1201148276 Y:11078737-11078759 CTAGTTTTTCAGTTTTACTTTGG - Intergenic
1201236218 Y:11914563-11914585 CCAGTTTTTCAGGTTAACTTTGG + Intergenic
1201286373 Y:12382044-12382066 CTTGTTTTTCAGGTTGACTTTGG + Intergenic
1201290121 Y:12414602-12414624 CTCGTTTTTCAGGTTAACTTTGG - Intergenic
1201433780 Y:13933699-13933721 CTAGTTTTCCAGGTAAATTTTGG - Intergenic
1201626040 Y:16015857-16015879 GTGGTTTTTTAGGTTTGTTTTGG + Intergenic
1201685521 Y:16697597-16697619 CTAGTTTTTCAGGCTAACTTTGG - Intergenic
1201916552 Y:19187894-19187916 CTAGATTTTCTAGTTTATTTGGG + Intergenic
1202165670 Y:21984967-21984989 GTATTTTTTCATGTGTCTTTTGG + Intergenic
1202225688 Y:22601405-22601427 GTATTTTTTCATGTGTCTTTTGG - Intergenic
1202317425 Y:23594256-23594278 GTATTTTTTCATGTGTCTTTTGG + Intergenic
1202553340 Y:26075802-26075824 GTATTTTTTCATGTGTCTTTTGG - Intergenic
1202596365 Y:26544732-26544754 CTTGCTTTTCATGTTTCTTGTGG - Intergenic