ID: 1047550937

View in Genome Browser
Species Human (GRCh38)
Location 8:125871582-125871604
Sequence GTGCCCACCCAGACTGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047550935_1047550937 16 Left 1047550935 8:125871543-125871565 CCTGCTTTTATTATGGCTACACT No data
Right 1047550937 8:125871582-125871604 GTGCCCACCCAGACTGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047550937 Original CRISPR GTGCCCACCCAGACTGAGAT TGG Intergenic
No off target data available for this crispr