ID: 1047552730

View in Genome Browser
Species Human (GRCh38)
Location 8:125894148-125894170
Sequence GGACATACCCTGAGATTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047552720_1047552730 30 Left 1047552720 8:125894095-125894117 CCTGAAATTGAAAGTAAGGGCTG No data
Right 1047552730 8:125894148-125894170 GGACATACCCTGAGATTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047552730 Original CRISPR GGACATACCCTGAGATTGGG AGG Intergenic
No off target data available for this crispr