ID: 1047559539

View in Genome Browser
Species Human (GRCh38)
Location 8:125971799-125971821
Sequence AGTACCAAAGGACCAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047559536_1047559539 15 Left 1047559536 8:125971761-125971783 CCTAGGGTATAATTATTCTGCTG No data
Right 1047559539 8:125971799-125971821 AGTACCAAAGGACCAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047559539 Original CRISPR AGTACCAAAGGACCAAAAGC TGG Intergenic
No off target data available for this crispr