ID: 1047561066

View in Genome Browser
Species Human (GRCh38)
Location 8:125988588-125988610
Sequence AACAGGAAGATGAGAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047561058_1047561066 20 Left 1047561058 8:125988545-125988567 CCCCATACATCTCACAAAGTAGA No data
Right 1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG No data
1047561055_1047561066 25 Left 1047561055 8:125988540-125988562 CCCACCCCCATACATCTCACAAA No data
Right 1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG No data
1047561060_1047561066 18 Left 1047561060 8:125988547-125988569 CCATACATCTCACAAAGTAGAAG No data
Right 1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG No data
1047561057_1047561066 21 Left 1047561057 8:125988544-125988566 CCCCCATACATCTCACAAAGTAG No data
Right 1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG No data
1047561059_1047561066 19 Left 1047561059 8:125988546-125988568 CCCATACATCTCACAAAGTAGAA No data
Right 1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG No data
1047561056_1047561066 24 Left 1047561056 8:125988541-125988563 CCACCCCCATACATCTCACAAAG No data
Right 1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG No data
1047561054_1047561066 26 Left 1047561054 8:125988539-125988561 CCCCACCCCCATACATCTCACAA No data
Right 1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047561066 Original CRISPR AACAGGAAGATGAGAGGAAG AGG Intergenic
No off target data available for this crispr