ID: 1047562242

View in Genome Browser
Species Human (GRCh38)
Location 8:126000056-126000078
Sequence GACTCTTATGTCAGAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047562239_1047562242 -1 Left 1047562239 8:126000034-126000056 CCTGGTAGAGCACTCATGGTGGG No data
Right 1047562242 8:126000056-126000078 GACTCTTATGTCAGAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047562242 Original CRISPR GACTCTTATGTCAGAAGAGG AGG Intergenic
No off target data available for this crispr