ID: 1047565105

View in Genome Browser
Species Human (GRCh38)
Location 8:126035384-126035406
Sequence CCTTATCTACTGTAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047565105_1047565110 10 Left 1047565105 8:126035384-126035406 CCCTGCAGCTACAGTAGATAAGG No data
Right 1047565110 8:126035417-126035439 GGACACATTTAGAAATTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047565105 Original CRISPR CCTTATCTACTGTAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr