ID: 1047565110

View in Genome Browser
Species Human (GRCh38)
Location 8:126035417-126035439
Sequence GGACACATTTAGAAATTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047565107_1047565110 9 Left 1047565107 8:126035385-126035407 CCTGCAGCTACAGTAGATAAGGC No data
Right 1047565110 8:126035417-126035439 GGACACATTTAGAAATTCTAAGG No data
1047565105_1047565110 10 Left 1047565105 8:126035384-126035406 CCCTGCAGCTACAGTAGATAAGG No data
Right 1047565110 8:126035417-126035439 GGACACATTTAGAAATTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047565110 Original CRISPR GGACACATTTAGAAATTCTA AGG Intergenic
No off target data available for this crispr