ID: 1047566725

View in Genome Browser
Species Human (GRCh38)
Location 8:126051922-126051944
Sequence CCTTCTGTGTAGGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047566720_1047566725 3 Left 1047566720 8:126051896-126051918 CCTTATCTGATCTGACTTTATTC No data
Right 1047566725 8:126051922-126051944 CCTTCTGTGTAGGAAGAGGAGGG No data
1047566719_1047566725 4 Left 1047566719 8:126051895-126051917 CCCTTATCTGATCTGACTTTATT No data
Right 1047566725 8:126051922-126051944 CCTTCTGTGTAGGAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047566725 Original CRISPR CCTTCTGTGTAGGAAGAGGA GGG Intergenic
No off target data available for this crispr