ID: 1047571058

View in Genome Browser
Species Human (GRCh38)
Location 8:126099093-126099115
Sequence GAGGGCTCCAAGGAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047571050_1047571058 29 Left 1047571050 8:126099041-126099063 CCCACAGTTAAGCTGGAAAGTGA No data
Right 1047571058 8:126099093-126099115 GAGGGCTCCAAGGAGACTGCTGG No data
1047571051_1047571058 28 Left 1047571051 8:126099042-126099064 CCACAGTTAAGCTGGAAAGTGAC No data
Right 1047571058 8:126099093-126099115 GAGGGCTCCAAGGAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047571058 Original CRISPR GAGGGCTCCAAGGAGACTGC TGG Intergenic
No off target data available for this crispr