ID: 1047571432

View in Genome Browser
Species Human (GRCh38)
Location 8:126102770-126102792
Sequence ATTTACTGGGTGGTGATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047571432_1047571437 18 Left 1047571432 8:126102770-126102792 CCTAACATCACCACCCAGTAAAT No data
Right 1047571437 8:126102811-126102833 TGCCTCAGAGTCGATTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047571432 Original CRISPR ATTTACTGGGTGGTGATGTT AGG (reversed) Intergenic